ID: 920089667

View in Genome Browser
Species Human (GRCh38)
Location 1:203443242-203443264
Sequence TGCAATGAAGAGGATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920089660_920089667 25 Left 920089660 1:203443194-203443216 CCAAAAAATATTTCAGAAAAACT No data
Right 920089667 1:203443242-203443264 TGCAATGAAGAGGATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920089667 Original CRISPR TGCAATGAAGAGGATGGGGT AGG Intergenic
No off target data available for this crispr