ID: 920099038

View in Genome Browser
Species Human (GRCh38)
Location 1:203505450-203505472
Sequence CTGGTGGTCCCCGAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920099030_920099038 14 Left 920099030 1:203505413-203505435 CCAGGCAATGAGTTGCCAAGGCA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 920099038 1:203505450-203505472 CTGGTGGTCCCCGAGTCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 146
920099032_920099038 -1 Left 920099032 1:203505428-203505450 CCAAGGCAACTATTCAAGGTCCC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 920099038 1:203505450-203505472 CTGGTGGTCCCCGAGTCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920099038 Original CRISPR CTGGTGGTCCCCGAGTCTGG AGG Intronic
900211769 1:1459711-1459733 CGGGTGGGCCCCAAGCCTGGAGG - Intronic
900224578 1:1527011-1527033 CGGGTGGGCCCCAAGCCTGGAGG - Intronic
901830106 1:11887040-11887062 CTGGTGTTCCCGGAGGCTGAGGG - Intergenic
902550357 1:17215531-17215553 CCGGTGGTCCCTGAGTGGGGTGG + Intronic
902809863 1:18881986-18882008 CTGGTTGGCACAGAGTCTGGTGG - Intronic
904613191 1:31736357-31736379 CTGGTGGTGGCCGTGTCTGTTGG - Exonic
905948365 1:41923463-41923485 ATGGTGGTACCAGAGGCTGGAGG + Intronic
907401855 1:54229282-54229304 CTTGAGGTCCCAGAGGCTGGAGG + Intronic
908023880 1:59927420-59927442 CTGGAGGTCCCACAGTCTTGGGG - Intergenic
908195438 1:61742596-61742618 CTGGGTGTCCCCGCGCCTGGAGG + Intronic
908452740 1:64272105-64272127 CTGGGGGTCCCCAGGTCTAGAGG - Intergenic
916685039 1:167136606-167136628 CTGGTGGTCCCTGAGAGGGGCGG + Intergenic
918173125 1:182017357-182017379 ATGGTGGTTACAGAGTCTGGAGG - Intergenic
920099038 1:203505450-203505472 CTGGTGGTCCCCGAGTCTGGAGG + Intronic
922739171 1:228006170-228006192 TTGGTGGTCCCAGAACCTGGGGG + Intergenic
1063276195 10:4570760-4570782 CTGGTGGTCTCCTAGTCTCATGG - Intergenic
1065994092 10:31040399-31040421 CTGGTGATCCCCCAGCCTGTAGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1070795968 10:79216418-79216440 CTGTGGGTCCCAGAGCCTGGTGG - Intronic
1071271162 10:84008982-84009004 CTGGTGGCCCCTGAGGCTGTCGG + Intergenic
1076341056 10:129745010-129745032 CTGGTCCTCCGTGAGTCTGGTGG + Intronic
1077302469 11:1853673-1853695 CTGCTGGGCCCCAAGCCTGGCGG - Intronic
1077393643 11:2310907-2310929 CTGGTGGGCCCTGAGGGTGGAGG - Intronic
1081850099 11:46269785-46269807 CTGGAGGTCCCCAAGTTTGTGGG + Intergenic
1081868832 11:46374214-46374236 CTGGAGTTCCACGAGTCTCGAGG + Exonic
1082564754 11:54663042-54663064 CTGGTGGTGCCCTGGGCTGGAGG + Intergenic
1083149623 11:60783642-60783664 CTGGGGGTCCCTGGATCTGGGGG + Intergenic
1083344048 11:61977211-61977233 CTGGTGTTGCCCCAGTTTGGAGG - Intergenic
1083707320 11:64525475-64525497 CTGGGGGTCCCAGATGCTGGAGG + Intergenic
1085385811 11:76157482-76157504 CTGGGGGTGCCTGGGTCTGGGGG + Intergenic
1085523947 11:77153666-77153688 ATGGTGGTCACCCAGGCTGGAGG - Intronic
1088129707 11:106472627-106472649 CTGGTGGTCAGAGCGTCTGGAGG + Intergenic
1089232058 11:116986941-116986963 ATGGTGGTGCCAGAGGCTGGAGG + Intronic
1093810977 12:23491681-23491703 CTGGTGGTCCCAGCTACTGGAGG - Intergenic
1094056007 12:26270166-26270188 CTGATAGTCCCAGATTCTGGAGG - Intronic
1096509793 12:52121446-52121468 CTGTTCCTCCCCGAGGCTGGAGG - Intergenic
1102396473 12:112590321-112590343 AGGGTGGTCTCCGAGGCTGGTGG - Intronic
1102967919 12:117142243-117142265 CAGGTGGTCCCTGAGTCTCCAGG - Intronic
1103463650 12:121124641-121124663 CTGGTGGTTACTGAGTGTGGAGG + Intergenic
1103477685 12:121230686-121230708 CTGGTGCTGCCCGAGGTTGGGGG - Intronic
1103615514 12:122149277-122149299 CTGGTGGGCTCAGAATCTGGTGG - Intergenic
1108706798 13:52996242-52996264 ATGGTGGTTCCCAAGCCTGGTGG + Intergenic
1113580798 13:111427277-111427299 CTGGTGGGTCCCGAGCCTGCTGG - Intergenic
1117823988 14:59681590-59681612 CTGGTGGTACCCATGTCTGGTGG - Intronic
1118873893 14:69766899-69766921 CGGCTGGTGCCGGAGTCTGGAGG - Exonic
1120657103 14:87204202-87204224 CTGGCGGTCCCCAAGCCTGATGG - Intergenic
1121733036 14:96199539-96199561 CTGTTGCTCCCCCAGGCTGGAGG - Intergenic
1122783925 14:104155333-104155355 CTGGTGTTCCCCGAGGTTGCAGG + Intronic
1122874852 14:104659314-104659336 CTGGTGGCCCTGGATTCTGGTGG + Intergenic
1129299055 15:74615229-74615251 CTGGCGGGGCCGGAGTCTGGAGG - Exonic
1130273344 15:82463739-82463761 CTCGTGGTGCCCGAGGGTGGTGG + Intergenic
1130486994 15:84403698-84403720 CTCGTGGTGCCCGAGGGTGGTGG - Intergenic
1130587985 15:85195705-85195727 CTCGTGGTGCCCGAGGGTGGTGG + Intergenic
1132347007 15:101114452-101114474 GTCGTGGGCCCTGAGTCTGGTGG + Intergenic
1136277937 16:29190632-29190654 CTGGTGCTCCAGGAGTCTGTAGG - Intergenic
1139331088 16:66190746-66190768 CTGGTGGGCCCCGCTTCTGTAGG - Intergenic
1141617707 16:85219770-85219792 CTGGTGGTCCCATAGTCATGGGG - Intergenic
1146181702 17:30702631-30702653 CTGGTGGTCCCCTGCTCTTGGGG + Intergenic
1147918105 17:43900558-43900580 CCGGGAGTCCCCGGGTCTGGGGG - Intronic
1148778998 17:50111251-50111273 CTGCTGGGCCCTGAGTATGGTGG - Exonic
1149601895 17:57898753-57898775 CTGGAGGTCCCTGAGTGGGGAGG - Intronic
1150227561 17:63532119-63532141 TTGGGGGTCCCCCTGTCTGGGGG + Intronic
1150306988 17:64093939-64093961 CTGGTGGTCACAGAGACTAGCGG + Intronic
1156485846 18:37465087-37465109 CTGGCCGTCCCAGAGCCTGGAGG - Intronic
1157473575 18:48007831-48007853 CTGCAGGTCCGCGAGCCTGGGGG + Intergenic
1157545101 18:48541005-48541027 CGGGTGGACCCCCAGTCTGCCGG - Intronic
1157607986 18:48938279-48938301 CTACTAGTCCCCAAGTCTGGGGG - Intronic
1160393540 18:78555824-78555846 CTGGTGGTCCCCCTGAATGGGGG - Intergenic
1160778561 19:867829-867851 CTAGTGGATGCCGAGTCTGGGGG - Intronic
1160974409 19:1785520-1785542 CTGGTGGTCGCTGAAGCTGGCGG + Exonic
1161065039 19:2233343-2233365 CTGGTGAGCCCCCAGGCTGGTGG - Exonic
1161238098 19:3207844-3207866 CTGTTGCTCTCCGAGACTGGGGG + Exonic
1161520033 19:4718722-4718744 CGGGTGGTCCCAGCGTCTGGTGG - Intronic
1161766515 19:6211731-6211753 CTGGGGGTCCCAGGGGCTGGAGG - Intergenic
1162341099 19:10091947-10091969 GTGCTGGTCCCCGTATCTGGTGG + Intronic
1162977131 19:14213174-14213196 CTGGTGGTCCCCTGCTCTTGGGG - Intergenic
1163628111 19:18402350-18402372 CTGGGGGTCCAGGGGTCTGGTGG + Intergenic
1163628129 19:18402414-18402436 CTGGGGGTCCTGCAGTCTGGGGG + Intergenic
1165780947 19:38433963-38433985 CTGGTGGTCTCTGAGACTCGAGG + Intronic
1167521590 19:49958965-49958987 CTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167710849 19:51109559-51109581 CTGGTGGTCCCTTAATCTAGAGG - Intergenic
1168355726 19:55698484-55698506 CTGGTGGGCCTGGACTCTGGTGG - Intronic
926083179 2:10005004-10005026 CTGGTGGTGTCAGAGTCTGAAGG - Intergenic
926185755 2:10689663-10689685 CTGGGCCTCCCCGAGTCGGGGGG + Intronic
926678958 2:15649667-15649689 GTGGTGGTCCCCGGGGCTGCTGG - Intergenic
927692963 2:25221353-25221375 CTGGTGGTGGCCGGGTGTGGTGG + Intergenic
931747928 2:65307078-65307100 TTTGTGGTCCCGCAGTCTGGAGG - Intergenic
932000180 2:67877807-67877829 CTGAGGGTCCCCCATTCTGGAGG + Intergenic
937080690 2:119137603-119137625 CTGGGGGTCCCCCTGTGTGGCGG - Intergenic
938289241 2:130140748-130140770 CTGGTGATCCCTGAGTTTGCGGG - Intronic
938467285 2:131532190-131532212 CTGGTGATCCCTGAGTTTGCGGG + Intronic
939535509 2:143422844-143422866 CTTGTGGTTCCCTATTCTGGTGG - Intronic
945880617 2:215321153-215321175 TTGGTGGTTGCCGAGGCTGGAGG - Intronic
946154849 2:217800674-217800696 TTGGAGGACCCCGAGTGTGGGGG + Exonic
1169143388 20:3238344-3238366 CCCGGGGTCTCCGAGTCTGGAGG - Intronic
1173750302 20:45470621-45470643 CCGGGGGTCCCCGGGTCCGGGGG - Intronic
1173895668 20:46548943-46548965 ATGGTGGTCCCCAAGGCTTGAGG - Intronic
1175266088 20:57704320-57704342 CAGGGGCTCCCCGAGGCTGGGGG - Intronic
1179500987 21:41808475-41808497 CTGGTGGCTCCCTAGTTTGGGGG - Intronic
1179623074 21:42631668-42631690 CTGGTGGTCCCACTGTTTGGTGG - Intergenic
1180226300 21:46394356-46394378 ATGGTGGGCGCTGAGTCTGGAGG + Intronic
1180233832 21:46444295-46444317 CTGGTGCTCCCTGGGCCTGGCGG + Intronic
1180924801 22:19545981-19546003 CTGGTGGTCCTAGAGTGTTGTGG + Intergenic
1182088319 22:27576603-27576625 CTGGTGCTCCCAGGGTCTGAGGG + Intergenic
1183364386 22:37399498-37399520 CTGGTGGTCCCCGTGGTCGGTGG - Intronic
1183364415 22:37399576-37399598 CTGGTGGTCCCCGTGGTCGGTGG - Intronic
1183364429 22:37399615-37399637 CTGGTGGTCCCCGTGGTCGGTGG - Intronic
1184217736 22:43078856-43078878 CCCGTGGTCCCCGTGTCTGTGGG - Intronic
1184217755 22:43078920-43078942 CCCGTGGTCCCCGTGTCTGTGGG - Intronic
1184217774 22:43078984-43079006 CCCGTGGTCCCCGTGTCTGTGGG - Intronic
1184217828 22:43079176-43079198 CCCGTGGTCCCCGTGTCTGTGGG - Intronic
1184803048 22:46774174-46774196 CTGGTTTTCCCCCAGCCTGGAGG - Intronic
950965199 3:17141259-17141281 CTGGTGTGCCCAGAGCCTGGAGG + Intergenic
951592025 3:24276763-24276785 CTGGTGGACCCAGTGTCTGCTGG + Intronic
954631912 3:52052382-52052404 CTGTCAGTCCCTGAGTCTGGAGG - Intronic
963247096 3:143073612-143073634 CTGGTGGTCCACGTTTCTGAAGG + Intergenic
964368350 3:155972766-155972788 CTCTTAGTCCCTGAGTCTGGAGG + Intergenic
966692572 3:182756801-182756823 CTGGGAGTCCCTGTGTCTGGGGG - Intergenic
968613442 4:1567233-1567255 CTGGTGGTACCCGGTACTGGTGG + Intergenic
976771642 4:88659456-88659478 CTGGTGGAGCCCGAGGCTGTAGG + Intronic
979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG + Intergenic
981698932 4:147586722-147586744 TTGGCAGCCCCCGAGTCTGGAGG + Intergenic
983766844 4:171494631-171494653 CTGGTGATCCATGAGTCTGGAGG - Intergenic
985530001 5:428533-428555 CTGTTGGTCCCCGAGCTTGTTGG + Intronic
985967602 5:3349392-3349414 CTGGTGGGACCTGAGGCTGGTGG - Intergenic
989314890 5:40066821-40066843 CTTGGGGTCCGGGAGTCTGGCGG + Intergenic
1002565820 5:180112657-180112679 CAGCTGGACCCCGAGTCTGTAGG - Intronic
1005453041 6:25992511-25992533 CTGCTGGACCCTGAGTCTGGCGG - Intergenic
1018984269 6:168623944-168623966 CTGGAGGTCACAGAGCCTGGCGG + Intronic
1019928647 7:4209252-4209274 CTGTGGGTCCCAGAGACTGGAGG + Intronic
1024059278 7:45686007-45686029 CTGGTGGTCCTTTCGTCTGGGGG + Exonic
1026889865 7:73975409-73975431 CAGGTGATGCCCCAGTCTGGAGG + Intergenic
1026976604 7:74502584-74502606 ATGGGGGTCCCCCAGCCTGGAGG + Intronic
1029506446 7:100966331-100966353 CGGGTGGACCCCGAGCCCGGAGG + Intronic
1033420295 7:141199491-141199513 CTGGTGGTCCCCCAGTGGGGAGG + Intronic
1039580943 8:38666540-38666562 CTGGCAGTCCCCCAGGCTGGCGG - Intergenic
1039597049 8:38799425-38799447 CTGTGGGGCTCCGAGTCTGGAGG + Intronic
1047616125 8:126563902-126563924 CTGGTGTTCCCTGAGGCTGCTGG - Intergenic
1049090505 8:140510829-140510851 GAGGAGGTCCCGGAGTCTGGTGG - Intergenic
1049586218 8:143433581-143433603 CTGGTGGTCCTCGTGTGTAGAGG + Intergenic
1050723043 9:8612722-8612744 CTGGGGGACCCTGAGGCTGGTGG + Intronic
1052032603 9:23645519-23645541 CTGGTGGCCCCCAAGCCTGAGGG - Intergenic
1053472951 9:38359832-38359854 CTGGGGGTCCCCAGGGCTGGTGG + Intergenic
1060758364 9:126228458-126228480 CTGCTGGAGCCCGAGGCTGGGGG + Intergenic
1062017655 9:134299228-134299250 CTGGAGGTCCCTGAAGCTGGTGG - Intergenic
1062273725 9:135721122-135721144 CTGGGGGTCCCCCAGTCCAGGGG - Intronic
1189333651 X:40157252-40157274 CTGGAGGGCCTGGAGTCTGGAGG - Intronic
1190278412 X:48913888-48913910 CCTGTGGTCCCTGATTCTGGAGG - Exonic
1193306832 X:79960343-79960365 CTGTTGGGCCTCGAGTCTGAGGG - Intergenic
1197766085 X:130060338-130060360 CTGCTGGTCCGCGAGGCTGAGGG + Intergenic
1200066049 X:153504536-153504558 CTGGTGTTCCGCGTGTGTGGTGG - Intronic
1200117566 X:153776046-153776068 CTGGTGGGGCCCGGGGCTGGCGG + Exonic