ID: 920099430

View in Genome Browser
Species Human (GRCh38)
Location 1:203507749-203507771
Sequence TGGGTAACCTTTGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 182}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920099430_920099440 7 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099440 1:203507779-203507801 CTAGGGCCAGAGGAGGCTCGTGG 0: 1
1: 0
2: 2
3: 13
4: 186
920099430_920099442 13 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099442 1:203507785-203507807 CCAGAGGAGGCTCGTGGAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 260
920099430_920099438 0 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099438 1:203507772-203507794 GCAAGGCCTAGGGCCAGAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 298
920099430_920099434 -10 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099434 1:203507762-203507784 AGGTTACCCAGCAAGGCCTAGGG 0: 1
1: 0
2: 0
3: 11
4: 103
920099430_920099445 18 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099445 1:203507790-203507812 GGAGGCTCGTGGAGAAGGGAGGG 0: 1
1: 0
2: 2
3: 53
4: 543
920099430_920099448 25 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099448 1:203507797-203507819 CGTGGAGAAGGGAGGGTGGGAGG 0: 1
1: 0
2: 22
3: 139
4: 1516
920099430_920099437 -3 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099437 1:203507769-203507791 CCAGCAAGGCCTAGGGCCAGAGG 0: 1
1: 0
2: 2
3: 20
4: 283
920099430_920099449 26 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099449 1:203507798-203507820 GTGGAGAAGGGAGGGTGGGAGGG 0: 1
1: 0
2: 26
3: 491
4: 4574
920099430_920099447 22 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099447 1:203507794-203507816 GCTCGTGGAGAAGGGAGGGTGGG 0: 1
1: 1
2: 2
3: 34
4: 367
920099430_920099444 17 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099444 1:203507789-203507811 AGGAGGCTCGTGGAGAAGGGAGG 0: 1
1: 0
2: 1
3: 31
4: 434
920099430_920099450 27 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099450 1:203507799-203507821 TGGAGAAGGGAGGGTGGGAGGGG 0: 1
1: 2
2: 27
3: 354
4: 2844
920099430_920099446 21 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099446 1:203507793-203507815 GGCTCGTGGAGAAGGGAGGGTGG 0: 1
1: 0
2: 8
3: 63
4: 672
920099430_920099443 14 Left 920099430 1:203507749-203507771 CCTGTTTTTCCAAAGGTTACCCA 0: 1
1: 0
2: 0
3: 10
4: 182
Right 920099443 1:203507786-203507808 CAGAGGAGGCTCGTGGAGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920099430 Original CRISPR TGGGTAACCTTTGGAAAAAC AGG (reversed) Intronic
901467944 1:9434992-9435014 TGGGTAAGCTGTGGGGAAACAGG - Intergenic
906277202 1:44525285-44525307 GGGGCCACCTTTGGCAAAACGGG + Intronic
906730789 1:48079327-48079349 TGAGTAACCTTGGTAAAAATGGG + Intergenic
907155355 1:52328812-52328834 AAAGTAACCTTTGGAAAACCTGG + Intronic
908291614 1:62672591-62672613 GTGATAATCTTTGGAAAAACTGG - Intronic
908448020 1:64220427-64220449 TATTTAACCTCTGGAAAAACTGG - Intronic
908925144 1:69244973-69244995 TTGTTTACCTTTGGAAAAAGTGG - Intergenic
909281160 1:73755592-73755614 TGTGTTACATTTGGTAAAACAGG + Intergenic
913474302 1:119222227-119222249 TGTTTAACTTTTGGAAAAACTGG + Intergenic
918999800 1:191815632-191815654 TGGGTCACATTTTCAAAAACTGG - Intergenic
919789619 1:201282897-201282919 TGGGTATGCCTTGGTAAAACCGG - Intergenic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063836918 10:10025557-10025579 TGGGTAACCTTCAGAATAAAGGG - Intergenic
1067203431 10:44194281-44194303 TAGGCAACCTTAGGAAAAGCTGG - Intergenic
1068145911 10:53070480-53070502 GGGCTAAACTTTAGAAAAACTGG + Intergenic
1068318732 10:55382097-55382119 TGGGTCACATTTTGAAACACTGG + Intronic
1068774646 10:60856906-60856928 AGGGTAACCTTTCCAAAAACAGG - Intergenic
1069931823 10:71888005-71888027 TGGCTGCCCTTTTGAAAAACTGG + Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1073749849 10:106512843-106512865 TGGGTTCCCTTTGAAAAATCAGG - Intergenic
1078628491 11:12980321-12980343 CAGGTAACCTTTGGAAACAAAGG + Intergenic
1079450410 11:20596477-20596499 GGGGTAGCCTTCTGAAAAACAGG - Intergenic
1079794757 11:24787128-24787150 TGGGTACCCTTCTGAAACACTGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081259927 11:40947098-40947120 TGAATAACCTTTGGAAATACAGG + Intronic
1081928072 11:46847267-46847289 TGGTCAAGATTTGGAAAAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083370275 11:62173436-62173458 TTGGTATCCTCTGCAAAAACAGG - Intergenic
1088357386 11:108958167-108958189 ATGTTAACATTTGGAAAAACCGG - Intergenic
1090992824 11:131835560-131835582 TGGGTAACATTAAAAAAAACTGG + Intronic
1091363453 11:134997034-134997056 TGTTAAACCTTTGGAAGAACTGG - Intergenic
1092574747 12:9768930-9768952 TGTATCACATTTGGAAAAACTGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096971414 12:55669366-55669388 TTGGTAACCTGTGAAGAAACTGG - Intergenic
1098779054 12:74661037-74661059 AGGGTAACCTTTGGAATGAGAGG - Intergenic
1100319915 12:93480951-93480973 TGGGCAACGTTTAGAAAAATAGG + Intronic
1104078983 12:125413891-125413913 TGTTTAACTTTTGGAGAAACTGG + Intronic
1105686762 13:22791416-22791438 TTGGGAACATGTGGAAAAACTGG + Intergenic
1106975146 13:35202558-35202580 TCGGTAAATTTTGTAAAAACAGG - Intronic
1107407146 13:40125599-40125621 TGGGGATCCTGTTGAAAAACAGG - Intergenic
1108334475 13:49425559-49425581 TTGGTAAACTATGCAAAAACAGG + Intronic
1109733026 13:66441282-66441304 TGGGTAATTTTTGGAAACACTGG - Intronic
1110577674 13:77078610-77078632 TGGGGAACATTTAGGAAAACAGG + Intronic
1112700704 13:102004638-102004660 TGAGTTGCCTTTGGAGAAACAGG + Intronic
1116262093 14:42643531-42643553 TGGCAAACATATGGAAAAACTGG - Intergenic
1117357210 14:54935832-54935854 TGGTTAACCTTTTGAGGAACTGG + Intergenic
1121540107 14:94719289-94719311 TGGGAGACATTTGGAATAACGGG - Intergenic
1127818063 15:62630123-62630145 TCTGTAACTATTGGAAAAACTGG + Intronic
1129712312 15:77826620-77826642 TGGGCAACCTTGGGCACAACGGG - Intergenic
1129736490 15:77968521-77968543 GGGATTACCTTTGGGAAAACTGG - Intergenic
1129849594 15:78785143-78785165 GGGATTACCTTTGGGAAAACTGG + Intronic
1130167606 15:81479563-81479585 TGGGTAAAAAGTGGAAAAACAGG + Intergenic
1131804545 15:96107698-96107720 TGGAGAACTTTGGGAAAAACTGG - Intergenic
1133693846 16:8241981-8242003 TGTGTAATCTTTGGCAAAACAGG - Intergenic
1133828719 16:9302222-9302244 CTGGGAATCTTTGGAAAAACGGG + Intergenic
1136352363 16:29719246-29719268 CGTGTAGCCTTTGAAAAAACTGG - Intergenic
1137381428 16:48003081-48003103 TGGGTAGCCTTGGGAGAAAATGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139086316 16:63590731-63590753 TGAGTAATTTTTGGAAAGACAGG - Intergenic
1139108983 16:63865240-63865262 TGGGTAACCATTGGAAAACATGG + Intergenic
1141295372 16:82763215-82763237 AGGGTAACCTGTGCAAAAAGAGG - Intronic
1141358051 16:83367545-83367567 GTGTTAACCTTTGGAGAAACTGG + Intronic
1146420902 17:32684444-32684466 TAGGTACTCTTTGGAAATACAGG - Intronic
1149472655 17:56931272-56931294 TAGGAACCCCTTGGAAAAACTGG + Intergenic
1149830860 17:59870580-59870602 TAGAGAACCTTTGGAAAACCAGG + Intronic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1150935047 17:69626308-69626330 TGGATAAGATTTGGAAAAAGTGG - Intergenic
1151692789 17:75697146-75697168 AGGAAAGCCTTTGGAAAAACAGG - Intronic
1154331580 18:13433783-13433805 TTTATAACCTTTGAAAAAACAGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1154488654 18:14901848-14901870 TGTTAAACCTTTGGAAGAACTGG + Intergenic
1155722019 18:29027361-29027383 TGGGTTACAGATGGAAAAACAGG + Intergenic
1156465303 18:37344991-37345013 TGGGTCATCTCTGGACAAACAGG - Intronic
1158630085 18:59105006-59105028 TGTGAAACTTTTAGAAAAACTGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166738492 19:45100121-45100143 TGGGGAGCTTTTGTAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168319598 19:55501019-55501041 TGTGTAGCCTTTGGAGAAATTGG - Exonic
925195028 2:1915830-1915852 TGGCTAACCTCTGGAAAGAAAGG + Intronic
929412800 2:41716004-41716026 TGGTTTCCTTTTGGAAAAACAGG - Intergenic
929893271 2:45936603-45936625 TGGGTAAGGTTAGGAAAACCTGG - Intronic
932099625 2:68886085-68886107 TGGGCCACCATTGGAAAGACAGG + Intergenic
934981636 2:98848273-98848295 GGGGTGACCTTTGGAACACCTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943135536 2:183906445-183906467 TGGTGAAAATTTGGAAAAACTGG - Intergenic
943442360 2:187941749-187941771 TAGTTACACTTTGGAAAAACAGG + Intergenic
948226340 2:236312069-236312091 TGGGTAACCTGTTGAACAATGGG - Intergenic
948758353 2:240172640-240172662 TGGGTGCCCTGTGGAAGAACAGG + Intergenic
949013733 2:241697459-241697481 TGGGTAAACTGTGGAACATCCGG + Intergenic
1169289341 20:4335325-4335347 TGGGTTTGTTTTGGAAAAACAGG - Intergenic
1169585334 20:7076139-7076161 TTGGAAACATTTGGAAAACCTGG + Intergenic
1172730616 20:37084069-37084091 TGGCTAATCTTTGTAGAAACAGG + Intronic
1173111374 20:40193498-40193520 TGGACCACATTTGGAAAAACAGG - Intergenic
1179022472 21:37652680-37652702 TGGGATAACTTTGGACAAACTGG + Intronic
1179041878 21:37810514-37810536 TGGGTAACGGTGGCAAAAACAGG - Intronic
1179244402 21:39618426-39618448 TGGGGAAGCTGTGGAAAAACAGG - Intronic
1181025434 22:20124815-20124837 TGGGTTCCCTTAGGAAAGACTGG + Intronic
1181149240 22:20870964-20870986 TGGGTAATTTTTGTAAAGACTGG - Intronic
1181741399 22:24924482-24924504 TGGGCAATCTTTGGTCAAACAGG - Exonic
1181993256 22:26854431-26854453 TGCTCAACCTTTGGAAAGACAGG - Intergenic
1185100862 22:48840227-48840249 TGGGGAACCCTTGGAGAACCTGG - Intronic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
951073310 3:18358975-18358997 TGTGTAACCTTTAGAAACTCTGG - Intronic
951668694 3:25155951-25155973 TGGGTGACCTTTGCCAACACAGG + Intergenic
953401735 3:42628457-42628479 TGGCAAACCTTTGGAGAAAATGG - Intronic
954468558 3:50673274-50673296 AGTATAAACTTTGGAAAAACTGG + Intergenic
955818188 3:62869472-62869494 TGAGTAAGCATAGGAAAAACAGG - Intronic
956515740 3:70045795-70045817 TGTGTTACCTTGGGAAAATCTGG + Intergenic
956882409 3:73524104-73524126 TGGGAAACATTTGGACTAACAGG + Intronic
957383295 3:79462504-79462526 TGTGTAACCTTTTAAAAGACAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964107226 3:153052293-153052315 TGTGCTACCTTTGGGAAAACTGG - Intergenic
967341051 3:188398399-188398421 TGAGAGACATTTGGAAAAACTGG - Intronic
967674179 3:192276619-192276641 TGGCTAACCTCAGGAAAAATTGG - Intronic
972316222 4:37928606-37928628 TGGGTATACTTTTGAAAATCTGG + Intronic
974298618 4:60036175-60036197 TGGTTAATAATTGGAAAAACAGG + Intergenic
974644805 4:64676194-64676216 GAGGTAACCTTGGGAAAAGCTGG + Intergenic
975073925 4:70180865-70180887 TGGCCAACCTTTGAAAACACTGG + Intergenic
975882200 4:78923716-78923738 TAGGTAACATTTGGAAAGAGAGG + Intronic
976078811 4:81331108-81331130 TAGGTAACCTTCAGAAAACCTGG + Intergenic
977012163 4:91650692-91650714 TGAGGAAACTTTGAAAAAACTGG - Intergenic
977424497 4:96850373-96850395 TTGGTAACCTTTGGAAAATAAGG - Intergenic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
978827164 4:113039313-113039335 AGGGTAACATTGTGAAAAACAGG + Intronic
979509755 4:121538902-121538924 TGGGTTTCTGTTGGAAAAACAGG - Intergenic
984035756 4:174665393-174665415 TGAGTGACCTTTGAAAAAAGTGG - Intronic
987428906 5:17807299-17807321 AGGGTCACCTTTGGAAACAACGG + Intergenic
988157611 5:27475625-27475647 TGGGAACCCCTTGGGAAAACTGG + Intergenic
991536513 5:67674628-67674650 TTGGTAACCACTGGAGAAACAGG - Intergenic
994976223 5:106810703-106810725 TGGCTTAGCTATGGAAAAACAGG - Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996344181 5:122471829-122471851 AGGCTGACCCTTGGAAAAACAGG - Intergenic
1000234552 5:159345354-159345376 TGGGTAGGCTTTGGACAGACAGG + Intergenic
1001491389 5:172158214-172158236 TGTTTAACCTTTCGAGAAACTGG - Intronic
1003387354 6:5681426-5681448 TGGATAACCATTGTGAAAACTGG - Intronic
1006331825 6:33397146-33397168 TGGGTAATTTTTGTAGAAACAGG + Intronic
1009758807 6:67977390-67977412 TGTCTATCCTTAGGAAAAACTGG + Intergenic
1010507403 6:76677050-76677072 TGGGTAACCTCTGATAATACAGG - Intergenic
1012175517 6:96077436-96077458 TGGATAAACTATGGAAAAATAGG - Intronic
1012952256 6:105530725-105530747 TGGGTAAAATTCGGAAAAGCAGG + Intergenic
1013330242 6:109094202-109094224 TGGGTGACATTTGGAACCACTGG + Exonic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016043535 6:139457791-139457813 TGGGGAACCTGGGGAAAGACTGG + Intergenic
1017418652 6:154249429-154249451 TGGGTAAGATTTGGGAAATCTGG + Intronic
1017570432 6:155738595-155738617 TGGTTAACCTTTGGAACAAAAGG - Intergenic
1021467349 7:20960058-20960080 TCGGTAAGCTTTGGATAGACAGG - Intergenic
1023377249 7:39569503-39569525 TGCTCAACCTTTGAAAAAACTGG - Intronic
1026292797 7:69023747-69023769 AGGTAAATCTTTGGAAAAACTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030149064 7:106384611-106384633 TGAGTGTCTTTTGGAAAAACAGG - Intergenic
1030667927 7:112301653-112301675 TGGGAAACTTTTGGAAAATGTGG - Intronic
1031620769 7:123931279-123931301 TGGCTGACTTTTGGAAAAAAGGG - Intronic
1034787833 7:153941552-153941574 TGGGTGACCTTTGGTATAAAAGG + Intronic
1035893764 8:3374417-3374439 AATGTAAACTTTGGAAAAACAGG - Intronic
1039719831 8:40151375-40151397 TCTGGAACCCTTGGAAAAACTGG + Intergenic
1040435707 8:47389262-47389284 TTGGTTACCTTTGCAAAAATAGG + Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1042447870 8:68909540-68909562 TGGGTCAACTTTGGAAAGAAAGG - Intergenic
1042943576 8:74132152-74132174 TATGTAACCTTTGAAAAAAATGG + Intergenic
1043093813 8:75938957-75938979 TGGGTCACCTATGTGAAAACTGG - Intergenic
1043796758 8:84551956-84551978 TCTGTAGCCTTTGGAAAAATGGG - Intronic
1043957307 8:86375899-86375921 TGGTTAGGCTTTGGGAAAACAGG - Intronic
1045666923 8:104497859-104497881 AGTGTAAACTTTGGTAAAACGGG + Exonic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1049302186 8:141877388-141877410 TGGGTCACCTTTGCCAGAACCGG + Intergenic
1050094394 9:2048146-2048168 TCGGTAAACTTTACAAAAACAGG + Intronic
1051482700 9:17577439-17577461 TGGGTAGCCTTTTTAAAAATTGG + Intergenic
1051822576 9:21184815-21184837 TGGTGAAGCTGTGGAAAAACAGG - Intergenic
1051827584 9:21237225-21237247 TGGTGAAGCTGTGGAAAAACAGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1056104766 9:83336363-83336385 TGGGGAGCATTTGGAAATACTGG - Intronic
1057695560 9:97320557-97320579 TGTGTGACCTTGGGAAAATCAGG + Intronic
1058208495 9:102136951-102136973 TGGGTAACTTATGAAAAAATAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058443696 9:105034340-105034362 TGGGAAAGTTTTGGAAATACTGG + Intergenic
1058889011 9:109345012-109345034 TTGGGAAGCTTTGGAAATACTGG - Intergenic
1062048887 9:134437228-134437250 TGAGTTATCTTTGGAAAAAGGGG - Intronic
1187582117 X:20618284-20618306 TGGCTAAGATTTGGAAAAATAGG + Intergenic
1188528685 X:31113741-31113763 TGAGTAAACTTTGGAGAAGCAGG + Intronic
1188542158 X:31262966-31262988 TGGATGACCTTTGGAAATAGAGG - Intronic
1189068140 X:37833822-37833844 TGGTTAACATTTTGCAAAACTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1196264823 X:113630550-113630572 TGGTGAACATGTGGAAAAACAGG + Intergenic
1196409905 X:115407343-115407365 TGGATTACCTTTAGAAAACCAGG + Intergenic
1196542734 X:116928461-116928483 TGAGTAATCTTTGGAAAATAAGG - Intergenic
1198061205 X:133046772-133046794 TCAGTCACCTTTGGAAAAAAAGG + Intronic
1199141012 X:144312486-144312508 GGGCTAACCTTTAGAAAATCAGG + Intergenic
1201019552 Y:9640942-9640964 TGCGTGACCTTTGGAAATGCTGG + Intergenic