ID: 920100072

View in Genome Browser
Species Human (GRCh38)
Location 1:203511765-203511787
Sequence GAAGGAGCCTATTGTACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920100072_920100078 29 Left 920100072 1:203511765-203511787 CCCTGAGTACAATAGGCTCCTTC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data
920100072_920100077 24 Left 920100072 1:203511765-203511787 CCCTGAGTACAATAGGCTCCTTC No data
Right 920100077 1:203511812-203511834 AACAAGCCCGAGTGTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920100072 Original CRISPR GAAGGAGCCTATTGTACTCA GGG (reversed) Intergenic
No off target data available for this crispr