ID: 920100073

View in Genome Browser
Species Human (GRCh38)
Location 1:203511766-203511788
Sequence GGAAGGAGCCTATTGTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920100073_920100077 23 Left 920100073 1:203511766-203511788 CCTGAGTACAATAGGCTCCTTCC No data
Right 920100077 1:203511812-203511834 AACAAGCCCGAGTGTGTTCTAGG No data
920100073_920100078 28 Left 920100073 1:203511766-203511788 CCTGAGTACAATAGGCTCCTTCC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920100073 Original CRISPR GGAAGGAGCCTATTGTACTC AGG (reversed) Intergenic
No off target data available for this crispr