ID: 920100075

View in Genome Browser
Species Human (GRCh38)
Location 1:203511783-203511805
Sequence CTGTTTACCAATAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920100075_920100078 11 Left 920100075 1:203511783-203511805 CCTTCCTGCTTATTGGTAAACAG No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data
920100075_920100077 6 Left 920100075 1:203511783-203511805 CCTTCCTGCTTATTGGTAAACAG No data
Right 920100077 1:203511812-203511834 AACAAGCCCGAGTGTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920100075 Original CRISPR CTGTTTACCAATAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr