ID: 920100076

View in Genome Browser
Species Human (GRCh38)
Location 1:203511787-203511809
Sequence GACTCTGTTTACCAATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920100076_920100077 2 Left 920100076 1:203511787-203511809 CCTGCTTATTGGTAAACAGAGTC No data
Right 920100077 1:203511812-203511834 AACAAGCCCGAGTGTGTTCTAGG No data
920100076_920100078 7 Left 920100076 1:203511787-203511809 CCTGCTTATTGGTAAACAGAGTC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920100076 Original CRISPR GACTCTGTTTACCAATAAGC AGG (reversed) Intergenic
No off target data available for this crispr