ID: 920100078

View in Genome Browser
Species Human (GRCh38)
Location 1:203511817-203511839
Sequence GCCCGAGTGTGTTCTAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920100072_920100078 29 Left 920100072 1:203511765-203511787 CCCTGAGTACAATAGGCTCCTTC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data
920100076_920100078 7 Left 920100076 1:203511787-203511809 CCTGCTTATTGGTAAACAGAGTC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data
920100075_920100078 11 Left 920100075 1:203511783-203511805 CCTTCCTGCTTATTGGTAAACAG No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data
920100073_920100078 28 Left 920100073 1:203511766-203511788 CCTGAGTACAATAGGCTCCTTCC No data
Right 920100078 1:203511817-203511839 GCCCGAGTGTGTTCTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920100078 Original CRISPR GCCCGAGTGTGTTCTAGGCT AGG Intergenic
No off target data available for this crispr