ID: 920102487

View in Genome Browser
Species Human (GRCh38)
Location 1:203526043-203526065
Sequence ATGGGAAGAAACAGAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920102482_920102487 16 Left 920102482 1:203526004-203526026 CCTGTCAGTGACTTACTGTTTGA No data
Right 920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG No data
920102486_920102487 -10 Left 920102486 1:203526030-203526052 CCTGGTCATCATTATGGGAAGAA No data
Right 920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG No data
920102481_920102487 22 Left 920102481 1:203525998-203526020 CCAAAACCTGTCAGTGACTTACT No data
Right 920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920102487 Original CRISPR ATGGGAAGAAACAGAATTCT TGG Intergenic
No off target data available for this crispr