ID: 920104440

View in Genome Browser
Species Human (GRCh38)
Location 1:203541389-203541411
Sequence CTAAAGGGCTGTTGCTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920104440_920104443 -9 Left 920104440 1:203541389-203541411 CCATAAGAGCAACAGCCCTTTAG No data
Right 920104443 1:203541403-203541425 GCCCTTTAGTCTCTAAAGTGGGG No data
920104440_920104448 22 Left 920104440 1:203541389-203541411 CCATAAGAGCAACAGCCCTTTAG No data
Right 920104448 1:203541434-203541456 TTGGTAACATTGAACCCACATGG No data
920104440_920104442 -10 Left 920104440 1:203541389-203541411 CCATAAGAGCAACAGCCCTTTAG No data
Right 920104442 1:203541402-203541424 AGCCCTTTAGTCTCTAAAGTGGG No data
920104440_920104447 3 Left 920104440 1:203541389-203541411 CCATAAGAGCAACAGCCCTTTAG No data
Right 920104447 1:203541415-203541437 CTAAAGTGGGGAAGGAAAGTTGG No data
920104440_920104446 -5 Left 920104440 1:203541389-203541411 CCATAAGAGCAACAGCCCTTTAG No data
Right 920104446 1:203541407-203541429 TTTAGTCTCTAAAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920104440 Original CRISPR CTAAAGGGCTGTTGCTCTTA TGG (reversed) Intergenic
No off target data available for this crispr