ID: 920108620

View in Genome Browser
Species Human (GRCh38)
Location 1:203571817-203571839
Sequence AGTCTCCTGCTTTCTAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920108617_920108620 -8 Left 920108617 1:203571802-203571824 CCTCCGACTTAGTTCAGTCTCCT No data
Right 920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG No data
920108616_920108620 -5 Left 920108616 1:203571799-203571821 CCACCTCCGACTTAGTTCAGTCT No data
Right 920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG No data
920108615_920108620 2 Left 920108615 1:203571792-203571814 CCGTCATCCACCTCCGACTTAGT No data
Right 920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG No data
920108614_920108620 18 Left 920108614 1:203571776-203571798 CCTTAATGAACAGTCTCCGTCAT No data
Right 920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920108620 Original CRISPR AGTCTCCTGCTTTCTAGGAA TGG Intergenic
No off target data available for this crispr