ID: 920108870

View in Genome Browser
Species Human (GRCh38)
Location 1:203573254-203573276
Sequence GGCCCTGCTGGGTTTTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920108870_920108878 16 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108878 1:203573293-203573315 ACCTGCAATCTCAGCACTTTGGG 0: 138
1: 6988
2: 98686
3: 321819
4: 236758
920108870_920108881 25 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108881 1:203573302-203573324 CTCAGCACTTTGGGTGGCTGAGG 0: 29
1: 6237
2: 99532
3: 220477
4: 245648
920108870_920108883 29 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108883 1:203573306-203573328 GCACTTTGGGTGGCTGAGGTGGG 0: 192
1: 32116
2: 135104
3: 234262
4: 234480
920108870_920108882 28 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108882 1:203573305-203573327 AGCACTTTGGGTGGCTGAGGTGG 0: 321
1: 61484
2: 149488
3: 156551
4: 113671
920108870_920108877 15 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108877 1:203573292-203573314 CACCTGCAATCTCAGCACTTTGG 0: 138
1: 6501
2: 86610
3: 221852
4: 256304
920108870_920108880 19 Left 920108870 1:203573254-203573276 CCTAAGGAAAACCCAGCAGGGCC No data
Right 920108880 1:203573296-203573318 TGCAATCTCAGCACTTTGGGTGG 0: 484
1: 24443
2: 318696
3: 259946
4: 146065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920108870 Original CRISPR GGCCCTGCTGGGTTTTCCTT AGG (reversed) Intergenic
No off target data available for this crispr