ID: 920109194

View in Genome Browser
Species Human (GRCh38)
Location 1:203575222-203575244
Sequence CCCTTGGTTCCCGACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920109194_920109201 17 Left 920109194 1:203575222-203575244 CCCTCAAAGTCGGGAACCAAGGG No data
Right 920109201 1:203575262-203575284 CACTCCAAGATCACAAGACAGGG No data
920109194_920109200 16 Left 920109194 1:203575222-203575244 CCCTCAAAGTCGGGAACCAAGGG No data
Right 920109200 1:203575261-203575283 ACACTCCAAGATCACAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920109194 Original CRISPR CCCTTGGTTCCCGACTTTGA GGG (reversed) Intergenic
No off target data available for this crispr