ID: 920109200

View in Genome Browser
Species Human (GRCh38)
Location 1:203575261-203575283
Sequence ACACTCCAAGATCACAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920109199_920109200 0 Left 920109199 1:203575238-203575260 CCAAGGGATGCTGGTGGCAGAGA No data
Right 920109200 1:203575261-203575283 ACACTCCAAGATCACAAGACAGG No data
920109192_920109200 20 Left 920109192 1:203575218-203575240 CCTGCCCTCAAAGTCGGGAACCA No data
Right 920109200 1:203575261-203575283 ACACTCCAAGATCACAAGACAGG No data
920109196_920109200 15 Left 920109196 1:203575223-203575245 CCTCAAAGTCGGGAACCAAGGGA No data
Right 920109200 1:203575261-203575283 ACACTCCAAGATCACAAGACAGG No data
920109194_920109200 16 Left 920109194 1:203575222-203575244 CCCTCAAAGTCGGGAACCAAGGG No data
Right 920109200 1:203575261-203575283 ACACTCCAAGATCACAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920109200 Original CRISPR ACACTCCAAGATCACAAGAC AGG Intergenic
No off target data available for this crispr