ID: 920110978

View in Genome Browser
Species Human (GRCh38)
Location 1:203586807-203586829
Sequence ATAGTGAGACAGATCAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920110978_920110979 5 Left 920110978 1:203586807-203586829 CCTTGTCTGATCTGTCTCACTAT No data
Right 920110979 1:203586835-203586857 TAACCTGAATTATTCATTAGCGG No data
920110978_920110980 6 Left 920110978 1:203586807-203586829 CCTTGTCTGATCTGTCTCACTAT No data
Right 920110980 1:203586836-203586858 AACCTGAATTATTCATTAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920110978 Original CRISPR ATAGTGAGACAGATCAGACA AGG (reversed) Intergenic
No off target data available for this crispr