ID: 920112958

View in Genome Browser
Species Human (GRCh38)
Location 1:203599886-203599908
Sequence CTGGTTGGACTGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920112958_920112968 18 Left 920112958 1:203599886-203599908 CCATGTCCCATCAGTCCAACCAG No data
Right 920112968 1:203599927-203599949 CTGGATCCAGATCCCAAGAGAGG No data
920112958_920112969 19 Left 920112958 1:203599886-203599908 CCATGTCCCATCAGTCCAACCAG No data
Right 920112969 1:203599928-203599950 TGGATCCAGATCCCAAGAGAGGG No data
920112958_920112963 -1 Left 920112958 1:203599886-203599908 CCATGTCCCATCAGTCCAACCAG No data
Right 920112963 1:203599908-203599930 GCTCCCAGTCCAACCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920112958 Original CRISPR CTGGTTGGACTGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr