ID: 920113901

View in Genome Browser
Species Human (GRCh38)
Location 1:203606377-203606399
Sequence TTTTCCTCTCCTCTTTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920113898_920113901 19 Left 920113898 1:203606335-203606357 CCTAGCTTGTAGAAATTACTCAG No data
Right 920113901 1:203606377-203606399 TTTTCCTCTCCTCTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920113901 Original CRISPR TTTTCCTCTCCTCTTTTCTT TGG Intergenic
No off target data available for this crispr