ID: 920114285

View in Genome Browser
Species Human (GRCh38)
Location 1:203609092-203609114
Sequence GCTACTTGAGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114285_920114293 17 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114285_920114288 -5 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114285_920114294 18 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114285_920114295 22 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG No data
920114285_920114297 24 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114285_920114296 23 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114285 Original CRISPR GCTACTTGAGAGGCTGAGGC AGG (reversed) Intergenic