ID: 920114285

View in Genome Browser
Species Human (GRCh38)
Location 1:203609092-203609114
Sequence GCTACTTGAGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 718735
Summary {0: 2868, 1: 83135, 2: 187074, 3: 222934, 4: 222724}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114285_920114293 17 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114285_920114297 24 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG 0: 26
1: 3180
2: 107910
3: 222565
4: 150269
920114285_920114296 23 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114285_920114288 -5 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114285_920114294 18 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114285_920114295 22 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG 0: 52
1: 6813
2: 203847
3: 139873
4: 65513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114285 Original CRISPR GCTACTTGAGAGGCTGAGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr