ID: 920114286

View in Genome Browser
Species Human (GRCh38)
Location 1:203609096-203609118
Sequence GCATGCTACTTGAGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114286_920114288 -9 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114286_920114295 18 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG No data
920114286_920114296 19 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG No data
920114286_920114294 14 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114286_920114297 20 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114286_920114293 13 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114286 Original CRISPR GCATGCTACTTGAGAGGCTG AGG (reversed) Intergenic