ID: 920114286

View in Genome Browser
Species Human (GRCh38)
Location 1:203609096-203609118
Sequence GCATGCTACTTGAGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128299
Summary {0: 3, 1: 16, 2: 244, 3: 7758, 4: 120278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114286_920114296 19 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114286_920114294 14 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114286_920114297 20 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG 0: 26
1: 3180
2: 107910
3: 222565
4: 150269
920114286_920114288 -9 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114286_920114293 13 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114286_920114295 18 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG 0: 52
1: 6813
2: 203847
3: 139873
4: 65513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114286 Original CRISPR GCATGCTACTTGAGAGGCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr