ID: 920114287

View in Genome Browser
Species Human (GRCh38)
Location 1:203609102-203609124
Sequence GGTGGTGCATGCTACTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114287_920114296 13 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114287_920114298 28 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222
920114287_920114294 8 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114287_920114297 14 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG 0: 26
1: 3180
2: 107910
3: 222565
4: 150269
920114287_920114293 7 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114287_920114295 12 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG 0: 52
1: 6813
2: 203847
3: 139873
4: 65513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114287 Original CRISPR GGTGGTGCATGCTACTTGAG AGG (reversed) Intergenic
No off target data available for this crispr