ID: 920114287

View in Genome Browser
Species Human (GRCh38)
Location 1:203609102-203609124
Sequence GGTGGTGCATGCTACTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114287_920114293 7 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114287_920114295 12 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG No data
920114287_920114294 8 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114287_920114296 13 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG No data
920114287_920114297 14 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114287_920114298 28 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114287 Original CRISPR GGTGGTGCATGCTACTTGAG AGG (reversed) Intergenic