ID: 920114288

View in Genome Browser
Species Human (GRCh38)
Location 1:203609110-203609132
Sequence GTAGCATGCACCACCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114281_920114288 23 Left 920114281 1:203609064-203609086 CCTCCACCTCCAGGGTTCAAGCG 0: 367
1: 12590
2: 58144
3: 121423
4: 161078
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114284_920114288 14 Left 920114284 1:203609073-203609095 CCAGGGTTCAAGCGATTCTCCTG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114286_920114288 -9 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114283_920114288 17 Left 920114283 1:203609070-203609092 CCTCCAGGGTTCAAGCGATTCTC 0: 1229
1: 46864
2: 146367
3: 216790
4: 160231
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114282_920114288 20 Left 920114282 1:203609067-203609089 CCACCTCCAGGGTTCAAGCGATT 0: 779
1: 30515
2: 94149
3: 143535
4: 100707
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114285_920114288 -5 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114288 Original CRISPR GTAGCATGCACCACCACACC CGG Intergenic
No off target data available for this crispr