ID: 920114288

View in Genome Browser
Species Human (GRCh38)
Location 1:203609110-203609132
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114283_920114288 17 Left 920114283 1:203609070-203609092 CCTCCAGGGTTCAAGCGATTCTC No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114282_920114288 20 Left 920114282 1:203609067-203609089 CCACCTCCAGGGTTCAAGCGATT No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114281_920114288 23 Left 920114281 1:203609064-203609086 CCTCCACCTCCAGGGTTCAAGCG No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114285_920114288 -5 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114284_920114288 14 Left 920114284 1:203609073-203609095 CCAGGGTTCAAGCGATTCTCCTG No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data
920114286_920114288 -9 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114288 1:203609110-203609132 GTAGCATGCACCACCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type