ID: 920114289

View in Genome Browser
Species Human (GRCh38)
Location 1:203609120-203609142
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114289_920114298 10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114289_920114294 -10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114289_920114295 -6 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG No data
920114289_920114296 -5 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG No data
920114289_920114299 15 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG No data
920114289_920114297 -4 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114289 Original CRISPR GCAAAATTAGCCGGGTGTGG TGG (reversed) Intergenic