ID: 920114289

View in Genome Browser
Species Human (GRCh38)
Location 1:203609120-203609142
Sequence GCAAAATTAGCCGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361605
Summary {0: 43, 1: 2395, 2: 27169, 3: 122893, 4: 209105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114289_920114294 -10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114289_920114297 -4 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG 0: 26
1: 3180
2: 107910
3: 222565
4: 150269
920114289_920114296 -5 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114289_920114295 -6 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG 0: 52
1: 6813
2: 203847
3: 139873
4: 65513
920114289_920114299 15 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
920114289_920114298 10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114289 Original CRISPR GCAAAATTAGCCGGGTGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr