ID: 920114290

View in Genome Browser
Species Human (GRCh38)
Location 1:203609123-203609145
Sequence AATGCAAAATTAGCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114290_920114297 -7 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114290_920114296 -8 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG No data
920114290_920114295 -9 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114295 1:203609137-203609159 TTTTGCATTTTTAGTAGGGACGG No data
920114290_920114298 7 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114290_920114299 12 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114290 Original CRISPR AATGCAAAATTAGCCGGGTG TGG (reversed) Intergenic