ID: 920114291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:203609128-203609150 |
| Sequence | CTAAAAATGCAAAATTAGCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920114291_920114299 | 7 | Left | 920114291 | 1:203609128-203609150 | CCCGGCTAATTTTGCATTTTTAG | No data | ||
| Right | 920114299 | 1:203609158-203609180 | GGGGTTTCTCCATGTTGGTCAGG | No data | ||||
| 920114291_920114298 | 2 | Left | 920114291 | 1:203609128-203609150 | CCCGGCTAATTTTGCATTTTTAG | No data | ||
| Right | 920114298 | 1:203609153-203609175 | GGGACGGGGTTTCTCCATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920114291 | Original CRISPR | CTAAAAATGCAAAATTAGCC GGG (reversed) | Intergenic | ||