ID: 920114292

View in Genome Browser
Species Human (GRCh38)
Location 1:203609129-203609151
Sequence ACTAAAAATGCAAAATTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114292_920114299 6 Left 920114292 1:203609129-203609151 CCGGCTAATTTTGCATTTTTAGT No data
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG No data
920114292_920114298 1 Left 920114292 1:203609129-203609151 CCGGCTAATTTTGCATTTTTAGT No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114292 Original CRISPR ACTAAAAATGCAAAATTAGC CGG (reversed) Intergenic