ID: 920114293

View in Genome Browser
Species Human (GRCh38)
Location 1:203609132-203609154
Sequence GCTAATTTTGCATTTTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114285_920114293 17 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114286_920114293 13 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114287_920114293 7 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114293 Original CRISPR GCTAATTTTGCATTTTTAGT AGG Intergenic