ID: 920114293

View in Genome Browser
Species Human (GRCh38)
Location 1:203609132-203609154
Sequence GCTAATTTTGCATTTTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114286_920114293 13 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114285_920114293 17 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data
920114287_920114293 7 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114293 Original CRISPR GCTAATTTTGCATTTTTAGT AGG Intergenic
No off target data available for this crispr