ID: 920114294

View in Genome Browser
Species Human (GRCh38)
Location 1:203609133-203609155
Sequence CTAATTTTGCATTTTTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4302
Summary {0: 10, 1: 320, 2: 240, 3: 377, 4: 3355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114287_920114294 8 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114285_920114294 18 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114286_920114294 14 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355
920114289_920114294 -10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG 0: 10
1: 320
2: 240
3: 377
4: 3355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114294 Original CRISPR CTAATTTTGCATTTTTAGTA GGG Intergenic
Too many off-targets to display for this crispr