ID: 920114294

View in Genome Browser
Species Human (GRCh38)
Location 1:203609133-203609155
Sequence CTAATTTTGCATTTTTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114289_920114294 -10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114287_920114294 8 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114286_920114294 14 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data
920114285_920114294 18 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114294 1:203609133-203609155 CTAATTTTGCATTTTTAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114294 Original CRISPR CTAATTTTGCATTTTTAGTA GGG Intergenic