ID: 920114296

View in Genome Browser
Species Human (GRCh38)
Location 1:203609138-203609160
Sequence TTTGCATTTTTAGTAGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516171
Summary {0: 55, 1: 5891, 2: 174906, 3: 211493, 4: 123826}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114285_920114296 23 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC 0: 2868
1: 83135
2: 187074
3: 222934
4: 222724
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114290_920114296 -8 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT 0: 35
1: 1948
2: 9564
3: 20210
4: 50135
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114286_920114296 19 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC 0: 3
1: 16
2: 244
3: 7758
4: 120278
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114289_920114296 -5 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826
920114287_920114296 13 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114296 1:203609138-203609160 TTTGCATTTTTAGTAGGGACGGG 0: 55
1: 5891
2: 174906
3: 211493
4: 123826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114296 Original CRISPR TTTGCATTTTTAGTAGGGAC GGG Intergenic
Too many off-targets to display for this crispr