ID: 920114297

View in Genome Browser
Species Human (GRCh38)
Location 1:203609139-203609161
Sequence TTGCATTTTTAGTAGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114286_920114297 20 Left 920114286 1:203609096-203609118 CCTCAGCCTCTCAAGTAGCATGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114290_920114297 -7 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114285_920114297 24 Left 920114285 1:203609092-203609114 CCTGCCTCAGCCTCTCAAGTAGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114289_920114297 -4 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data
920114287_920114297 14 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114297 1:203609139-203609161 TTGCATTTTTAGTAGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114297 Original CRISPR TTGCATTTTTAGTAGGGACG GGG Intergenic