ID: 920114298

View in Genome Browser
Species Human (GRCh38)
Location 1:203609153-203609175
Sequence GGGACGGGGTTTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114290_920114298 7 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114289_920114298 10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114287_920114298 28 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114291_920114298 2 Left 920114291 1:203609128-203609150 CCCGGCTAATTTTGCATTTTTAG No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data
920114292_920114298 1 Left 920114292 1:203609129-203609151 CCGGCTAATTTTGCATTTTTAGT No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114298 Original CRISPR GGGACGGGGTTTCTCCATGT TGG Intergenic