ID: 920114298

View in Genome Browser
Species Human (GRCh38)
Location 1:203609153-203609175
Sequence GGGACGGGGTTTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 354663
Summary {0: 83, 1: 7612, 2: 58807, 3: 145939, 4: 142222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114290_920114298 7 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT 0: 35
1: 1948
2: 9564
3: 20210
4: 50135
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222
920114287_920114298 28 Left 920114287 1:203609102-203609124 CCTCTCAAGTAGCATGCACCACC No data
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222
920114289_920114298 10 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222
920114291_920114298 2 Left 920114291 1:203609128-203609150 CCCGGCTAATTTTGCATTTTTAG 0: 346
1: 16076
2: 19231
3: 12575
4: 21779
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222
920114292_920114298 1 Left 920114292 1:203609129-203609151 CCGGCTAATTTTGCATTTTTAGT 0: 355
1: 15649
2: 11132
3: 5841
4: 9521
Right 920114298 1:203609153-203609175 GGGACGGGGTTTCTCCATGTTGG 0: 83
1: 7612
2: 58807
3: 145939
4: 142222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114298 Original CRISPR GGGACGGGGTTTCTCCATGT TGG Intergenic
Too many off-targets to display for this crispr