ID: 920114299

View in Genome Browser
Species Human (GRCh38)
Location 1:203609158-203609180
Sequence GGGGTTTCTCCATGTTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 513112
Summary {0: 12353, 1: 30279, 2: 108113, 3: 178545, 4: 183822}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920114292_920114299 6 Left 920114292 1:203609129-203609151 CCGGCTAATTTTGCATTTTTAGT 0: 355
1: 15649
2: 11132
3: 5841
4: 9521
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
920114291_920114299 7 Left 920114291 1:203609128-203609150 CCCGGCTAATTTTGCATTTTTAG 0: 346
1: 16076
2: 19231
3: 12575
4: 21779
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
920114289_920114299 15 Left 920114289 1:203609120-203609142 CCACCACACCCGGCTAATTTTGC 0: 43
1: 2395
2: 27169
3: 122893
4: 209105
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
920114290_920114299 12 Left 920114290 1:203609123-203609145 CCACACCCGGCTAATTTTGCATT 0: 35
1: 1948
2: 9564
3: 20210
4: 50135
Right 920114299 1:203609158-203609180 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920114299 Original CRISPR GGGGTTTCTCCATGTTGGTC AGG Intergenic
Too many off-targets to display for this crispr