ID: 920115515

View in Genome Browser
Species Human (GRCh38)
Location 1:203618060-203618082
Sequence CTCCAGATGACACTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920115515_920115519 6 Left 920115515 1:203618060-203618082 CCAGGCTCCAGTGTCATCTGGAG No data
Right 920115519 1:203618089-203618111 AAGAGCTGGGATTCAGTTCCTGG No data
920115515_920115518 -7 Left 920115515 1:203618060-203618082 CCAGGCTCCAGTGTCATCTGGAG No data
Right 920115518 1:203618076-203618098 TCTGGAGAAGCAGAAGAGCTGGG No data
920115515_920115517 -8 Left 920115515 1:203618060-203618082 CCAGGCTCCAGTGTCATCTGGAG No data
Right 920115517 1:203618075-203618097 ATCTGGAGAAGCAGAAGAGCTGG No data
920115515_920115521 18 Left 920115515 1:203618060-203618082 CCAGGCTCCAGTGTCATCTGGAG No data
Right 920115521 1:203618101-203618123 TCAGTTCCTGGCAAGGAGATAGG No data
920115515_920115520 11 Left 920115515 1:203618060-203618082 CCAGGCTCCAGTGTCATCTGGAG No data
Right 920115520 1:203618094-203618116 CTGGGATTCAGTTCCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920115515 Original CRISPR CTCCAGATGACACTGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr