ID: 920117215

View in Genome Browser
Species Human (GRCh38)
Location 1:203629374-203629396
Sequence TGCACTCTGAGCCTCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920117215_920117221 22 Left 920117215 1:203629374-203629396 CCATCGTGGAGGCTCAGAGTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 920117221 1:203629419-203629441 CTATTTTCAGTAATCTGATTAGG 0: 1
1: 0
2: 3
3: 16
4: 225
920117215_920117216 -6 Left 920117215 1:203629374-203629396 CCATCGTGGAGGCTCAGAGTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 920117216 1:203629391-203629413 AGTGCAGCTATTCCTGCAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 160
920117215_920117222 23 Left 920117215 1:203629374-203629396 CCATCGTGGAGGCTCAGAGTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 920117222 1:203629420-203629442 TATTTTCAGTAATCTGATTAGGG 0: 1
1: 0
2: 0
3: 36
4: 370
920117215_920117223 24 Left 920117215 1:203629374-203629396 CCATCGTGGAGGCTCAGAGTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 920117223 1:203629421-203629443 ATTTTCAGTAATCTGATTAGGGG 0: 1
1: 0
2: 2
3: 18
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920117215 Original CRISPR TGCACTCTGAGCCTCCACGA TGG (reversed) Intronic
900211046 1:1456030-1456052 AGCACCCTGAGCCTACACGAGGG - Intronic
900216872 1:1486349-1486371 AGCACCCTGAGCCTACACGAGGG - Intronic
900223953 1:1524078-1524100 AGCACCCTGAGCCTACACGAGGG - Intronic
901921660 1:12541429-12541451 TGCACTCTGTGGCCCCAGGAAGG - Intergenic
902735045 1:18394955-18394977 TGCCTCCTGAGCCTCCAAGAGGG + Intergenic
904770136 1:32876537-32876559 TCCACTCTGAGCCTCTAAAATGG - Intergenic
906826339 1:48984545-48984567 TGCACTGTGAGTGTCCAAGAAGG + Intronic
908301158 1:62761832-62761854 TGCAGCCTGAGCCTCCCCAACGG + Intergenic
908911697 1:69078965-69078987 TGGACTTTAAGCCTCCACAATGG + Intergenic
913175078 1:116266147-116266169 TGCACCCTGGGCCTGCAGGATGG + Intergenic
913201214 1:116496453-116496475 TGCTCTCTGAGGTTCCACCATGG - Intergenic
919070660 1:192751392-192751414 TGCAGCCCGAGCCTCCCCGACGG + Intergenic
920117215 1:203629374-203629396 TGCACTCTGAGCCTCCACGATGG - Intronic
922012442 1:221604248-221604270 TTCCCTCTGACCCTCCAAGATGG - Intergenic
923160889 1:231313725-231313747 TGCAGTCTTAGCCACTACGAAGG - Intergenic
1067406806 10:46030709-46030731 TGCGCTCTGCGCCTCCTAGAGGG - Intronic
1067571701 10:47376566-47376588 TGCACTCATATCCTCCAAGAAGG + Intronic
1070534985 10:77370316-77370338 TGCAGTCTAAGCCTCCAGGTGGG + Intronic
1072915812 10:99536838-99536860 TGCACTCTGCCCCACCTCGAGGG + Intergenic
1075582649 10:123633968-123633990 TGCCCTCTGTGACTCCATGAGGG - Intergenic
1084561463 11:69907862-69907884 TGCACACTGGGCCTCCATGGAGG + Intergenic
1089321045 11:117626903-117626925 AGCACCCTGATCCTCCAGGAAGG + Intronic
1090586149 11:128215335-128215357 TGCAGCCTGAGCCTCCCTGACGG - Intergenic
1090729400 11:129557238-129557260 TGCACTCAGTGACTCCACGCAGG - Intergenic
1095146561 12:38736015-38736037 AGTACTCTGGGCCTCCAAGAGGG + Intronic
1095785992 12:46109600-46109622 TGCACTCTTAGACTCCAGTAGGG + Intergenic
1101173743 12:102127145-102127167 AGCACTCTGAGAGTCCATGATGG + Intronic
1105428064 13:20312833-20312855 TACCCTCTGAGCCTCCAACATGG - Intergenic
1114186689 14:20407969-20407991 TGCTCTCTGAGCCTCCAAGTTGG - Exonic
1114193060 14:20455201-20455223 TGCACGCTGAGCCCCCACGTGGG - Exonic
1114957736 14:27845442-27845464 TGCACTCTGAGCGGCCAGGCTGG + Intergenic
1116988225 14:51244120-51244142 TGCACACTGAGCCCCCAGCAGGG - Intronic
1118928069 14:70212254-70212276 TGCAGGCAGAGCCTCCATGATGG + Intergenic
1121015058 14:90544070-90544092 TCCACTCTGAGCCTCCACAGGGG - Intronic
1121720581 14:96105942-96105964 TGCACTTTGATCCTCCAAAAGGG + Intergenic
1123130911 14:105984608-105984630 TGCACTCTGAGCAACCACTGAGG - Intergenic
1123581143 15:21715829-21715851 TGCACTCTGAGCAACCACTGAGG - Intergenic
1123617792 15:22158452-22158474 TGCACTCTGAGCAACCACTGAGG - Intergenic
1126883996 15:53130235-53130257 TGCCCTGTGAGCCTACACGTCGG + Intergenic
1128878317 15:71220609-71220631 TTCACTTTGAGCATCCACTATGG - Intronic
1129266337 15:74395497-74395519 AACACTCTGAGCCTTCATGAAGG + Intergenic
1129607862 15:77033572-77033594 TGCCCTGTGAGCATCCACAAGGG + Intronic
1131422714 15:92320575-92320597 TGCTCTCTGAGCATGCAAGAAGG + Intergenic
1132673786 16:1113475-1113497 TGGGCTCTGAGCCTCCGGGATGG - Intergenic
1133441137 16:5821784-5821806 TGCCCTCTTAGCATCCAGGATGG + Intergenic
1133613555 16:7455109-7455131 TGCAATCTGAGGCTTCAAGATGG - Intronic
1133721602 16:8499379-8499401 TGAACTGTGAGCTTCCAGGAGGG + Intergenic
1141551084 16:84807139-84807161 TGCACTCTGAGGATGGACGAAGG - Intergenic
1145264684 17:21374134-21374156 TGAACTCTGACCCTGCACGTGGG + Intergenic
1146693693 17:34893352-34893374 TGCCCTCTGACCCTGCACTAGGG - Intergenic
1148087072 17:45000728-45000750 TTCTCTCTGAGGCTCCAGGATGG - Intergenic
1152328694 17:79657921-79657943 TGCCCTCTGTGTCTCCAGGAGGG - Intergenic
1152334756 17:79694333-79694355 TGCCCTTTGAGCCTCCACAGAGG + Intergenic
1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG + Intergenic
1156405173 18:36776314-36776336 TACACCCTGAGCCTCTGCGATGG - Intronic
1156524477 18:37753808-37753830 TGCACTGTGAATCTCCAAGAAGG + Intergenic
1159015919 18:63101594-63101616 TGCTCTCTCAGACACCACGAAGG + Intergenic
1166549808 19:43657686-43657708 TGGACTGTGAGCCCCCAGGAGGG + Intronic
925552187 2:5088391-5088413 TGGACTCTGAGGCTACACCAAGG + Intergenic
926800204 2:16653328-16653350 TCCAGTCTGAGCCTCAGCGAGGG - Intronic
927020646 2:19013410-19013432 TGAACTCGGAAGCTCCACGAAGG + Intergenic
929994540 2:46817155-46817177 GGCACTGTAAGCCTCCACAATGG - Intronic
932104037 2:68926825-68926847 TGGGCTCTGAACCTCCAGGAGGG + Intergenic
932529692 2:72515777-72515799 TGCATTCTGAAGTTCCACGAAGG - Intronic
935526215 2:104171315-104171337 TGCACTCTGAGCTGCCTGGATGG - Intergenic
936062367 2:109303537-109303559 TTCCTTCTGAGCCTCCAGGAAGG + Intronic
942067357 2:172284312-172284334 TGCACTCTGTGAATCCACCAAGG + Intergenic
942505441 2:176637626-176637648 TCCAGGCGGAGCCTCCACGATGG + Intergenic
946686034 2:222270943-222270965 TGCACTCTGAGACAGCAAGAAGG + Intronic
948494284 2:238336868-238336890 TTCACTCACAGCCTCCACTATGG - Intronic
1171420857 20:25016653-25016675 TGCACTCAGAACATCCACAAGGG + Intronic
1173268830 20:41512860-41512882 TGCACTCTCAGCCTCTACACTGG - Exonic
1175282688 20:57814618-57814640 TTCACTCTGAGGCTCCAAGATGG + Intergenic
1175927531 20:62478178-62478200 GGCACTCTGGGTCTCCGCGAGGG + Intergenic
1176070033 20:63221454-63221476 TGCTCCCTGAGCCTCCACCTTGG - Intergenic
1180185879 21:46138976-46138998 TGCCCTCTGAGCTCCCACAAGGG + Intronic
1181269641 22:21651742-21651764 TGCTCTCTGCGCCTCCTGGATGG - Intergenic
1181464695 22:23104647-23104669 AGCACTCTTAGCCTCCACCTTGG - Intronic
1182061913 22:27404499-27404521 TGCATTCTGAGGCTCTACGGGGG + Intergenic
1183357320 22:37366716-37366738 TTCACTGTGAGCCTGCACCAAGG - Intergenic
949661312 3:6282459-6282481 TGCACCTGAAGCCTCCACGAAGG + Intergenic
950106037 3:10389302-10389324 TGCTCTCTGAGCCTGCATGGTGG - Intronic
950633358 3:14298714-14298736 TGGGCTCTGAGGCTCCACCAGGG + Intergenic
951930945 3:27966521-27966543 AGCACTCTGAGCCTCCAGTGAGG - Intergenic
953023851 3:39133595-39133617 TGCAGGCTGAGCTTCCAAGAGGG + Intronic
960559996 3:119073466-119073488 TGCGGCCTGAGCCTCCCCGATGG - Intronic
962398712 3:135039487-135039509 TGCAGCCCGAGCCTCCCCGACGG - Intronic
963844911 3:150145322-150145344 TCCACCCTAAGCCTCCAAGATGG + Intergenic
968000155 3:195200024-195200046 TACACTGTGACCCTCCAAGAAGG + Intronic
969381804 4:6804954-6804976 TGCACCCGGAACCTCCAAGAAGG - Intronic
969521030 4:7677881-7677903 TGCCCTCTGAGCCTCTAGGAGGG + Intronic
972746251 4:41935326-41935348 GGAACTCTGAGCCTCCACCAGGG - Exonic
976829546 4:89298899-89298921 TGAAATCTGAGCCTCCGAGAGGG - Intronic
978333248 4:107638550-107638572 TCCACTCTGAGCCCCCACTCTGG - Intronic
983515287 4:168649538-168649560 TGCTTTCTGTGCCTCCACAATGG + Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
984227853 4:177056331-177056353 TGCACTGTAAGCATCCACAAAGG - Intergenic
984599623 4:181711313-181711335 TCCACTGTGTGCCTCCAGGAGGG + Intergenic
985387448 4:189462459-189462481 TGCCCTTGGAGCCTCCACGGAGG + Intergenic
986107138 5:4670759-4670781 TGCACGCAGAGCCTCCACACTGG - Intergenic
986658863 5:10041346-10041368 TCCTCTCAGAGCCTCCAGGAAGG - Intergenic
988181201 5:27796627-27796649 TGCAGTCTGGGCCTCCCTGATGG + Intergenic
990425345 5:55682651-55682673 TGTACTCTCAGCCTCCAGGGAGG + Intronic
992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG + Intergenic
992792958 5:80230098-80230120 AGCAGGCTGAGCCTCCAAGAGGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001355112 5:171013258-171013280 TTCAGTCTGATGCTCCACGAAGG - Intronic
1003046699 6:2740058-2740080 TGCACTCTATGCCACCATGAAGG - Intronic
1004465236 6:15879051-15879073 TAGACTCTGAGCCTCCTTGACGG + Intergenic
1007062696 6:38956187-38956209 GGGAGTCTGAGCCTCCATGAAGG + Intronic
1009786125 6:68341909-68341931 TGCACTTGGAGCCACCAAGATGG + Intergenic
1013703771 6:112807416-112807438 TGCACTCTGAATCTCCCAGAGGG - Intergenic
1014780451 6:125559209-125559231 TGACTTCTGAGCCTCCAGGATGG + Intergenic
1019659393 7:2215613-2215635 ATCACTCTGAGCCCCCAGGATGG + Intronic
1021524893 7:21576144-21576166 TTGACTCTGAGGCTCCACCATGG + Intronic
1022583009 7:31575566-31575588 TGCACTTTCAGCCTCCTAGAGGG + Intronic
1023058988 7:36311658-36311680 TGAACCCTGAGCCTCCAGGCTGG + Intergenic
1023877089 7:44292638-44292660 TGTACTGTGAACCTCCAAGAAGG + Intronic
1024164133 7:46713388-46713410 TGCAATGTGAGCCTCTAAGAAGG + Intronic
1028913032 7:96229010-96229032 TGCAGCCTGAGCCTCCCCAACGG + Intronic
1034548135 7:151802376-151802398 TGGACTCTGACCTTCCAGGATGG + Intronic
1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG + Intronic
1040535388 8:48304748-48304770 TGCGCTGTGAGTCTCCAAGAGGG + Intergenic
1042782394 8:72506207-72506229 TGCACCCTGAGCTGCCAGGATGG + Intergenic
1045339064 8:101235333-101235355 TGCACTCTGTTCCTGCATGAAGG + Intergenic
1045790510 8:105978248-105978270 TGCACACTCAGCCTCCAGGTTGG + Intergenic
1047337322 8:123949238-123949260 TGCACTGTGACTCTCCAAGAGGG - Intronic
1048163942 8:132045481-132045503 TGAGCTCTGAGCTTCCAAGAAGG - Intronic
1050368089 9:4891073-4891095 TGCACTGTAAGTCTCCAAGATGG - Intergenic
1053373463 9:37583338-37583360 TTCTCTCTGAGCCTCCAGCAAGG + Intronic
1053876162 9:42548260-42548282 TGCACAGGGAGCCTCCAGGAAGG - Intergenic
1054235535 9:62553462-62553484 TGCACAGGGAGCCTCCAGGAAGG + Intergenic
1058838219 9:108878651-108878673 TTCACTCAGTGCCTCCAGGAGGG + Exonic
1059382247 9:113935403-113935425 TGCCCTCTGAGCTTCCATAAAGG + Intronic
1059416777 9:114167520-114167542 TGCCCTCTCAGCCACCACCATGG + Intronic
1060256578 9:122036016-122036038 TGGAAACTGAGCCTCCAGGATGG - Intronic
1186522484 X:10218504-10218526 TGGACTCTGAGCTTCTAGGATGG - Intronic
1189783568 X:44539566-44539588 CTCCCTCTGAGCCTCCAAGAAGG + Intronic
1193679512 X:84501424-84501446 CTTACTCTGAGCCTCCACAATGG + Intronic
1197059405 X:122159677-122159699 TGCACTCTGTACCCCCACCATGG + Intergenic
1199218513 X:145289957-145289979 TGCAGACTCAGCCTCCAGGATGG - Intergenic
1199838197 X:151614807-151614829 AGGACTCTGAGCTTCCAAGAAGG - Intronic