ID: 920119051

View in Genome Browser
Species Human (GRCh38)
Location 1:203642023-203642045
Sequence TAACCCTCTGGGCGTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920119042_920119051 30 Left 920119042 1:203641970-203641992 CCAATGTCAGAGGGAAAAATGAC 0: 1
1: 0
2: 0
3: 22
4: 271
Right 920119051 1:203642023-203642045 TAACCCTCTGGGCGTGCTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
920119048_920119051 -5 Left 920119048 1:203642005-203642027 CCACTGAGAACAGTGGGGTAACC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 920119051 1:203642023-203642045 TAACCCTCTGGGCGTGCTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920119051 Original CRISPR TAACCCTCTGGGCGTGCTTC TGG Intronic
900422321 1:2560961-2560983 CCTCCCTCTGGGCCTGCTTCTGG - Intronic
900488508 1:2934925-2934947 AGACCCTCTGGGCGTGTTTTGGG + Intergenic
911122985 1:94314341-94314363 TGACCATCTGGGCGGGCATCAGG + Intergenic
915310951 1:155005572-155005594 GAAGCCTCTGGGCCTGCTGCGGG + Intronic
915713812 1:157925604-157925626 TAACCCTGCAGGGGTGCTTCCGG - Intergenic
920119051 1:203642023-203642045 TAACCCTCTGGGCGTGCTTCTGG + Intronic
1064122160 10:12629219-12629241 CAAACCTCTGGGCTTTCTTCAGG + Intronic
1067433681 10:46263084-46263106 TACCCCTCTGGGCAAGCTACTGG + Intergenic
1067440000 10:46303224-46303246 TACCCCTCTGGGCAAGCTACTGG - Intronic
1073345948 10:102783089-102783111 CACCCCTCTGGGTGTGGTTCTGG + Intronic
1075041825 10:119114079-119114101 AAACCCTCTGGGCCTCCTTCTGG - Intronic
1078335096 11:10456896-10456918 TAACCCACTTGGGGTGCTGCAGG - Intronic
1087461685 11:98455169-98455191 TCCCCCACTGGGAGTGCTTCTGG + Intergenic
1096583258 12:52601822-52601844 TGACCCTCTGGGTGTGTGTCTGG + Intergenic
1111633944 13:90879260-90879282 TGACCCCCTGGGCTTGTTTCAGG + Intergenic
1137426951 16:48387688-48387710 TAACGCTCTGGTCCTGCATCTGG + Intronic
1140789967 16:78382114-78382136 TACCTCTCTGGGCTTGTTTCAGG - Intronic
1151803207 17:76389960-76389982 TAAACCTCTGGGCCTGTCTCTGG + Exonic
1152409080 17:80112889-80112911 TAACCTGCTGGGGGTGCCTCTGG + Intergenic
1152586017 17:81189843-81189865 TGACCCTGTGGGTGTGCTGCAGG - Exonic
1155552595 18:26981596-26981618 CAACCCTCAGGGCTTGCCTCTGG + Intronic
1156311255 18:35924177-35924199 AATGCCTCTGGGGGTGCTTCAGG + Intergenic
1158072673 18:53491821-53491843 TAATCCTTTGGGCATGATTCTGG + Intronic
1159228103 18:65567222-65567244 TATCCTTCTGCGCATGCTTCAGG + Intergenic
1160448792 18:78947669-78947691 AAACCCTCTCGGCGTGATTGCGG - Intergenic
1160662662 19:308349-308371 TTACCCTCTGGGCTTGCTGGAGG - Intronic
926142074 2:10373756-10373778 TAAACCTCTGGGGGTGGTGCTGG - Intronic
926359720 2:12074839-12074861 TAATCCTCTGCCCGTGCATCTGG + Intergenic
929149306 2:38733414-38733436 TAACCATTTGGGTGTGCTTCTGG - Intronic
1185016700 22:48347414-48347436 TAGCCCTCAGGGCTTGCTCCTGG + Intergenic
958064979 3:88532881-88532903 TAACCCTCTTAGAGTGCTTTTGG + Intergenic
961059615 3:123817440-123817462 TTCCCCTCTGGGCCTGCATCTGG + Intronic
961145060 3:124586454-124586476 TAACTCTCTGGGCGTCTTGCTGG + Intronic
965690837 3:171355251-171355273 TGCCCCTCTGAGAGTGCTTCAGG - Intronic
968089476 3:195891556-195891578 TGTGCCTCTGGGCTTGCTTCCGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
974107702 4:57489529-57489551 TAAACCTTTGGCCGTGCTTATGG + Intergenic
982854134 4:160360514-160360536 GAACCCTTTGAGCTTGCTTCAGG + Intergenic
990336291 5:54775985-54776007 TAACCCTCTGTCCCTGCCTCTGG + Intergenic
990621973 5:57569828-57569850 TAACTATCTGGGTGGGCTTCTGG - Intergenic
1002340925 5:178516146-178516168 TACCCCTCTTCCCGTGCTTCAGG + Intronic
1002452195 5:179325479-179325501 TGACCCTCTGGGAGTGGGTCGGG - Intronic
1008050188 6:46893221-46893243 CAACCCTCTTGGCTTGCTTGAGG + Intronic
1015497000 6:133892697-133892719 TAACCCTTAGGGTGTGTTTCAGG + Exonic
1021638699 7:22717123-22717145 TAACCATCTGGGGGTGGTTGTGG - Intergenic
1033055381 7:138047844-138047866 AAACCTTCTGGCCGTTCTTCAGG - Intronic
1056321843 9:85442674-85442696 TAAGCCTGTAGGTGTGCTTCTGG - Intergenic
1059173697 9:112149992-112150014 AAACACTCTGGGCAAGCTTCTGG - Intronic
1061127112 9:128684101-128684123 AAACCCTTTGGGGGTGCTTAGGG - Intronic
1194151387 X:90328659-90328681 TAAGCTTCTGGACGTGCTACTGG - Intergenic
1196483852 X:116181620-116181642 TAACAATCTGGGCATGCTCCAGG + Intergenic
1200497750 Y:3905404-3905426 TAAGCTTCTGGACGTGCTACTGG - Intergenic