ID: 920122761

View in Genome Browser
Species Human (GRCh38)
Location 1:203671119-203671141
Sequence TTGGAATATAAAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920122761_920122762 -5 Left 920122761 1:203671119-203671141 CCTGCAGCATCTTTATATTCCAA 0: 1
1: 0
2: 1
3: 20
4: 283
Right 920122762 1:203671137-203671159 TCCAACTAGCTGTTTCTGAAAGG 0: 1
1: 0
2: 3
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920122761 Original CRISPR TTGGAATATAAAGATGCTGC AGG (reversed) Intronic
901160978 1:7176626-7176648 TTGGGATAGACAGATGCTGAGGG + Intronic
902191546 1:14766636-14766658 TGGGAAGACAAAGATGCTGAGGG + Intronic
902624395 1:17668219-17668241 TTGGAAAATCAAGCTGCTCCCGG + Intronic
904015385 1:27416023-27416045 TTGGAAGGAGAAGATGCTGCAGG - Exonic
909043583 1:70683391-70683413 TTGGTATATAGAAATGCTACTGG + Intergenic
910483689 1:87686382-87686404 TTGGAATATAAAGAAGGGGTGGG + Intergenic
911142438 1:94520293-94520315 ATTCAATATAGAGATGCTGCTGG - Intergenic
915784977 1:158600403-158600425 TTGTAATATCAAGGTGATGCTGG - Intergenic
918195502 1:182218016-182218038 TTTGAATCTAAAAATGCTGAGGG - Intergenic
918751455 1:188276690-188276712 TTGTAATATGATGATGCTTCTGG - Intergenic
919146996 1:193648355-193648377 TTGGTATATAGAGATGTTACTGG + Intergenic
920122761 1:203671119-203671141 TTGGAATATAAAGATGCTGCAGG - Intronic
921567914 1:216742465-216742487 TGGGAATATAAAGATGAACCAGG - Intronic
923057343 1:230436963-230436985 TTGAAATATAAAGATTGAGCTGG + Intergenic
923144506 1:231188450-231188472 CTGGAGAATAAAGATGCAGCTGG + Intronic
923161541 1:231318699-231318721 GTGGAATCTGAAGGTGCTGCTGG + Intergenic
924274528 1:242372134-242372156 TAGGAATATACAGGAGCTGCAGG - Intronic
924359433 1:243221323-243221345 TTAGAAAATAAAGATGGAGCTGG - Intronic
924401167 1:243683985-243684007 TTGGAAGACAAAGCTGCTGCAGG - Intronic
1063090158 10:2858129-2858151 TAGGAACAGAAAGATCCTGCTGG - Intergenic
1063329906 10:5147371-5147393 TTGGAATTTTAAGTTGGTGCTGG - Intergenic
1063982938 10:11470506-11470528 TTGGCATATAAAAATGTTACTGG - Intronic
1064446992 10:15404015-15404037 TTGGCATATAGAAATGCTACTGG - Intergenic
1065598250 10:27339148-27339170 TTAGAATATAAAGATTCTTGGGG - Intergenic
1067366484 10:45634839-45634861 TTGGTATATAGAAATGCTACTGG - Intronic
1071062413 10:81588436-81588458 TTGGAATATGAAGTTTCTACTGG + Intergenic
1071249219 10:83799460-83799482 TTGGTATATAGGGATGCTACTGG + Intergenic
1074605318 10:114957966-114957988 TTAGAAAATAAAGATGATGATGG + Intronic
1075023992 10:118970379-118970401 TGGCCATATAAAGAGGCTGCAGG - Intergenic
1075350905 10:121724431-121724453 TTGAAATATAAACTTGCTGATGG - Intergenic
1075830163 10:125402625-125402647 TTGGCATATAGAAATGCTACTGG + Intergenic
1077598591 11:3556408-3556430 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084254673 11:67932280-67932302 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084818200 11:71663607-71663629 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1087031498 11:93709949-93709971 TTGGCATATAGAAATGCTACTGG + Intronic
1090408652 11:126492720-126492742 GTGAAATATCAAGATGCTGAGGG + Intronic
1090989846 11:131806940-131806962 TGGGGATATAAAGAAACTGCTGG + Intronic
1091035747 11:132231828-132231850 TGATAATATCAAGATGCTGCTGG + Intronic
1091562123 12:1622861-1622883 TAGAAATAGAATGATGCTGCTGG + Intronic
1091868191 12:3861102-3861124 TTGGACTTTAAAGTTGATGCTGG + Intronic
1092424739 12:8365759-8365781 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1092907042 12:13110657-13110679 TTGGCATATCAAGATGTTCCAGG - Intronic
1092999111 12:13979270-13979292 CTGGAATTGAAGGATGCTGCAGG - Intronic
1095356738 12:41283516-41283538 TTGGGATATCAGGATGATGCTGG - Intronic
1095921317 12:47533934-47533956 TTGGAAAATGAAGCTGCTTCAGG + Intergenic
1096450125 12:51732868-51732890 TTGGCATATAGAAATGCTTCTGG + Intronic
1098397666 12:70039002-70039024 TTTGAAAATAAAAATGCTGGGGG + Intergenic
1099089799 12:78292132-78292154 TTAAAATATAAAGATGCTTTTGG + Intergenic
1099366826 12:81775899-81775921 TTGGGATATAAAGAGGCTCTTGG + Intergenic
1099422947 12:82485856-82485878 TAGGAACATAAAGATACTTCTGG - Intergenic
1099641391 12:85290442-85290464 TTGGAAGGTAAAAATGCTTCTGG + Intronic
1100470546 12:94888971-94888993 TTGGAAAAAAAAGATGCACCTGG + Intergenic
1100914768 12:99407683-99407705 TTGGCATATAGAAATGCTACTGG - Intronic
1101027328 12:100623934-100623956 TTGGGATGAGAAGATGCTGCTGG - Exonic
1103220051 12:119236511-119236533 TTGGAATTCAAAGGAGCTGCTGG - Intergenic
1104411248 12:128559910-128559932 TTTGAAAAGAAAGATGGTGCTGG - Intronic
1106093469 13:26620800-26620822 ATGGCATATAAAGATCCTCCAGG - Intronic
1106738390 13:32611911-32611933 TTGAAAAGTAAAGATTCTGCTGG - Intronic
1108863109 13:54886828-54886850 TTGGAGTGTAAAGCTGTTGCAGG - Intergenic
1109214761 13:59576701-59576723 TTGGCATATATAAATGCTACTGG - Intergenic
1110138091 13:72092723-72092745 TTAGAATATAAAAATGATGTGGG + Intergenic
1111995859 13:95165714-95165736 TTGGAATGTTCTGATGCTGCAGG - Intronic
1115182502 14:30645636-30645658 TTGGTGTATAGAAATGCTGCTGG + Intronic
1116157044 14:41218733-41218755 TTGGTATATAAGAATGCTACTGG - Intergenic
1117141237 14:52792298-52792320 TTGGAATCTACAGATGGTGGAGG + Intergenic
1118241334 14:64061477-64061499 TTGGAATACTTATATGCTGCTGG - Intronic
1118664393 14:68051417-68051439 TTGCTATATAAATATGCTGTAGG + Intronic
1128803276 15:70511110-70511132 TTGGTTTATAAAAATGCTGCTGG - Intergenic
1129913541 15:79247755-79247777 TTGGAATAAGAAGATGGGGCAGG + Intergenic
1131958934 15:97767555-97767577 TTGAGAGAGAAAGATGCTGCTGG + Intergenic
1134230799 16:12427949-12427971 TTGGCAAATGAAGCTGCTGCAGG - Intronic
1134426550 16:14154018-14154040 TTTAAATATAAAGATGCAGATGG - Intronic
1137237264 16:46626159-46626181 TTGGAATGTGAAGATGGTGGAGG + Intergenic
1140137691 16:72222306-72222328 TTGGAATGAAAAGAAGCTGAGGG - Intergenic
1140780944 16:78295820-78295842 TTCGAAAATAAAAATGCTGGGGG - Intronic
1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG + Intronic
1144117159 17:12107946-12107968 TAGTTATATAGAGATGCTGCTGG + Intronic
1144187450 17:12809841-12809863 GTGGGAGATAAAGCTGCTGCTGG + Intronic
1144562702 17:16334696-16334718 TTGGAATTTATAGATGCTATAGG - Intronic
1145215029 17:21044411-21044433 ATGGAATATAAGGATGCAGAGGG - Intergenic
1146822427 17:35994389-35994411 TTGGTGTATAAAAATGCTACTGG - Intronic
1147176574 17:38659511-38659533 TTGGCATAAAGAGAAGCTGCAGG - Intergenic
1147399632 17:40172570-40172592 TTGAAAAGTGAAGATGCTGCTGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1153446951 18:5184522-5184544 TTGGTGTATAGAGATGCTACTGG - Intronic
1158861388 18:61595411-61595433 ATGTAAGAAAAAGATGCTGCAGG - Intergenic
1168449524 19:56454020-56454042 TTGGCATATAGAAATGCTGCTGG - Intronic
926078909 2:9967442-9967464 TTCTAATACAAATATGCTGCAGG - Intronic
926753090 2:16214781-16214803 AAGGTATATAAAGATGTTGCTGG - Intergenic
928384626 2:30856003-30856025 TTGGCATGTAGAAATGCTGCTGG - Intergenic
928461460 2:31477094-31477116 TTTGAAGATAAAGATCCTGTGGG + Intergenic
928535880 2:32240850-32240872 TTTGAATAAAATGATGCTGAAGG + Intronic
929116153 2:38446020-38446042 TAGGAATATAGAGGTGCTGTGGG - Intergenic
929641360 2:43583228-43583250 TTGTAGGATAAAGATGCAGCAGG - Intronic
932365629 2:71151376-71151398 TTAGAATTTAAAGTTGATGCCGG - Intergenic
933010797 2:77060333-77060355 TTGTAATATAAAGATGCTATTGG + Intronic
933358027 2:81239360-81239382 TTGAAATATAAAGAAGCTGAGGG - Intergenic
933627906 2:84622768-84622790 TGGGAATATAAACATGGTACAGG - Intronic
933803066 2:85978313-85978335 CTGAAATAGAAAGATGCGGCCGG - Intergenic
934149527 2:89132271-89132293 TTGGTATATAGAAATGCTACTGG - Intergenic
935101922 2:100004290-100004312 TTTAAAAATAAAGATACTGCTGG - Intronic
935964294 2:108457762-108457784 TTGGTATATAGAAATGCTACTGG + Intronic
937318595 2:120947590-120947612 TTGGAATATAGAGTGTCTGCTGG - Intronic
937382438 2:121392090-121392112 TAGAAGTATAAAGATGCTGTTGG - Intronic
937617561 2:123944149-123944171 TTGGTATATACAAATGCTGCTGG + Intergenic
939168963 2:138671595-138671617 TGGGAAGACAAAGATGCTCCAGG - Exonic
940503369 2:154522587-154522609 TTGGCATATAGAAATGCTACTGG + Intergenic
941496610 2:166212664-166212686 ATGGTATATTAAGATGCTGTTGG - Intronic
941860065 2:170269945-170269967 TTAGGAGATAACGATGCTGCTGG + Intronic
943545341 2:189269723-189269745 TTTTAATATAAGGATGATGCTGG + Intergenic
943667306 2:190623014-190623036 TTGGCATATATAAATGCTACTGG - Intergenic
944395338 2:199260178-199260200 TGGGAATACAAAGATATTGCAGG + Intergenic
945718061 2:213382807-213382829 GTGGAATATAAAGATGGTCAAGG + Intronic
1171158748 20:22901858-22901880 TTGGTATATAGAAATGCTGCTGG - Intergenic
1171567907 20:26211621-26211643 TTGGAATATAAAGATCATATAGG - Intergenic
1173482163 20:43410656-43410678 TTGGTATATAGAAATGCTACTGG - Intergenic
1174628599 20:51936773-51936795 TTGAAATTTAAAGATGCAGATGG + Intergenic
1175849264 20:62079673-62079695 TTTGAATATTAACGTGCTGCTGG - Intergenic
1177069041 21:16479151-16479173 TTGGTATATAGAAATGCTACTGG + Intergenic
1177571816 21:22896819-22896841 TTGAAAAATAAAGTTGCTGGAGG + Intergenic
1178255706 21:31050380-31050402 AGAGAATATAAAGATGCTGCTGG - Intergenic
1180763736 22:18229732-18229754 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1180771908 22:18394811-18394833 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1180803287 22:18644424-18644446 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1181218430 22:21350837-21350859 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1181597421 22:23925478-23925500 GTTGAATATAAAAATGCTCCAGG - Intergenic
1182335746 22:29582276-29582298 TTGAACTATAAATTTGCTGCCGG + Intergenic
1182584897 22:31339256-31339278 TAGGAATGTAAATCTGCTGCTGG + Intronic
1182791230 22:32954725-32954747 TTGGGGTAAGAAGATGCTGCTGG + Intronic
1203233745 22_KI270731v1_random:135801-135823 CTGGAATTTAAATCTGCTGCAGG - Intergenic
949803029 3:7924008-7924030 CTGGAATATAAACATGCTCCAGG - Intergenic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
951648107 3:24916409-24916431 TAGGAATACTAAAATGCTGCAGG - Intergenic
951904683 3:27693128-27693150 TTGGCATATAGAAATGCTACTGG - Intergenic
955176520 3:56619580-56619602 TTGGAATTTAAAGTTGTTGACGG - Intronic
957068755 3:75548863-75548885 TTGGGATGTGAGGATGCTGCAGG - Intergenic
957341574 3:78905084-78905106 TTAAAACATAAAGATGCTGCAGG + Intronic
957356242 3:79091042-79091064 TTGGAATTTAAATCAGCTGCAGG + Intronic
958440528 3:94150917-94150939 TTGGAGTATAAGGCTGCTTCTGG + Intergenic
958679878 3:97314892-97314914 TTGCTAGATAAAGATGCAGCTGG - Intronic
959497713 3:107070858-107070880 TGTAAATACAAAGATGCTGCTGG + Intergenic
959668056 3:108943437-108943459 TTGGAGTATAAAGTAGCTGAGGG + Intronic
959819234 3:110712863-110712885 TTGGAAAAGAAAAATGTTGCTGG + Intergenic
961750383 3:129090851-129090873 TTGGAATGTGAAGATGGTGGAGG + Exonic
962224068 3:133590056-133590078 TTGTAATTTAAATCTGCTGCAGG - Exonic
962453455 3:135541709-135541731 TGGGACTATTAAGATGCTCCAGG + Intergenic
962734385 3:138311943-138311965 TTGGTATATACATATGCTACGGG - Intronic
963701770 3:148635520-148635542 TTGGCATATAGAAATGATGCTGG - Intergenic
965093886 3:164197352-164197374 TTGGTATATAGAAATGCTACTGG - Intergenic
965352743 3:167635120-167635142 TAGGAATATATATATGTTGCTGG - Intronic
965400644 3:168208737-168208759 TTGGATTATAAAGAAGGTTCAGG + Intergenic
966135359 3:176692021-176692043 GTTGCATGTAAAGATGCTGCTGG + Intergenic
966371227 3:179252489-179252511 TTAGAACCTAAAGATGTTGCTGG - Intronic
966378521 3:179321698-179321720 TTGAAATATAAAGATTTTGTTGG + Intergenic
966453291 3:180086436-180086458 TTAGAATTTAAAGTTGTTGCTGG + Intergenic
966708249 3:182941799-182941821 TTGGAATAAAAAAGTGGTGCTGG - Exonic
968279885 3:197468438-197468460 TAAGAAAATAAAGATGCAGCTGG + Intergenic
968480159 4:829707-829729 TTGGAATATCAAAATCCAGCAGG - Intergenic
969013083 4:4083400-4083422 TTGGGATGTGAGGATGCTGCAGG - Intergenic
969740760 4:9024390-9024412 TTGGGATGTGAGGATGCTGCAGG + Intergenic
969800099 4:9557222-9557244 TTGGGATGTGAGGATGCTGCAGG + Intergenic
970894824 4:21089788-21089810 TTGAAATGTAAAGAAGCTGGGGG - Intronic
972278014 4:37576389-37576411 TTGGCATATAGAAATGCTACAGG + Intronic
972951550 4:44330513-44330535 TTGTAATACAAAGATGCAACTGG - Intronic
973056076 4:45659661-45659683 CTGGAATTTGAAGATGCTGCTGG + Intergenic
974056945 4:56992998-56993020 TTGGAATAGAAAGAGGCTAGAGG + Intronic
974219019 4:58941951-58941973 TTTGAATATAAAGAAAGTGCTGG + Intergenic
974444176 4:61957840-61957862 ATGAAATAAAAAGATGCTACAGG - Intronic
975752143 4:77534788-77534810 TTGGACCATAAAGAAGCTTCAGG + Intronic
975859289 4:78659124-78659146 TTGGAAAATAAAGATTGTGTGGG + Intergenic
976136381 4:81941436-81941458 TTGGCATATATAAATGTTGCTGG - Intronic
978117221 4:105034389-105034411 TTGGCATATAGAAATGCTGCTGG - Intergenic
978253503 4:106662910-106662932 TTGTAATATAAAGATAAGGCAGG - Intergenic
979110998 4:116756519-116756541 TTGAAAAGTAAAGAAGCTGCTGG + Intergenic
979616722 4:122751108-122751130 TTGGCATATAGATATGCTACTGG - Intergenic
979945088 4:126819692-126819714 TTGGCATATAAAAATGCTACTGG - Intergenic
980339199 4:131520596-131520618 TTAGAATATAGAAATGCTACTGG + Intergenic
982122542 4:152156827-152156849 TTGGACTCTAAAGGAGCTGCAGG - Intergenic
983750456 4:171262068-171262090 TTAGTATATAAAGATGCAACTGG + Intergenic
984071115 4:175114146-175114168 TTGGTATATAGAAATGCTACTGG - Intergenic
984923395 4:184785576-184785598 TTAGAATAAAAAGATCCTCCTGG + Intronic
985209679 4:187579454-187579476 TAGAAATATAAAAATGCAGCTGG + Intergenic
987926170 5:24344800-24344822 TTAGACTTTAAAGATGATGCAGG - Intergenic
989672994 5:43941251-43941273 TTGGCATATAGAAGTGCTGCTGG - Intergenic
992164402 5:74034872-74034894 TTGGAGTGCAATGATGCTGCAGG + Intergenic
992840377 5:80684483-80684505 TTAGCATATAGAAATGCTGCTGG + Intronic
992944182 5:81793711-81793733 ATGAAATCTAAATATGCTGCTGG + Intergenic
993453297 5:88098496-88098518 ATGGAATATAAAGATGATTAAGG - Intergenic
994248372 5:97507521-97507543 TTGGCATATATAAATGCTACTGG + Intergenic
994300667 5:98143293-98143315 TTGGAATGTAAAGAGGGTGGGGG - Intergenic
995085073 5:108099050-108099072 TGGGAATATAAAGTAGTTGCTGG - Intronic
995363871 5:111331920-111331942 TGGGAATATAAGGATGGTTCTGG - Intronic
995684247 5:114754513-114754535 TTAGAATAAAAAGTTGCTGGAGG - Intergenic
998873020 5:146571519-146571541 TTTGAATATCAGGATGATGCAGG + Intergenic
1000166838 5:158658113-158658135 TTGGCATATAAAGATGAACCTGG - Intergenic
1001199669 5:169704863-169704885 TTTAAAAATAAACATGCTGCTGG + Intronic
1001872664 5:175170374-175170396 TTGGAGTATCAGGATGCTGTGGG + Intergenic
1003416291 6:5911310-5911332 TTGGAATTTAAGGATAATGCTGG + Intergenic
1003775549 6:9358279-9358301 TTGGCATATATAAATGCTACTGG - Intergenic
1005849023 6:29805031-29805053 TTGGAATTTAGAGTTGATGCTGG + Intergenic
1006484813 6:34330498-34330520 TTAGAAAATAAAAATGGTGCTGG + Intronic
1006955073 6:37862382-37862404 TTGGAATTTAAATCTGCTGCAGG + Intronic
1007617973 6:43193314-43193336 TTGGAATGGAAAGATGCAGATGG + Intronic
1008752405 6:54751740-54751762 TTAGAATATAAAAATACAGCTGG - Intergenic
1008903580 6:56651553-56651575 TTGGATTGGAAAGATGCTGTTGG - Intronic
1009216207 6:60923151-60923173 TTGGTATAAACAGATTCTGCTGG - Intergenic
1009408210 6:63334297-63334319 TTGGTGTATAGAAATGCTGCTGG - Intergenic
1010047344 6:71461207-71461229 TGTGAATATAGAGATGCTGAAGG - Intergenic
1010119258 6:72354680-72354702 GTAGAATATAAAGATTCTGATGG + Intronic
1010175891 6:73027540-73027562 TTGCCAAATAAAGATCCTGCTGG + Intronic
1010291691 6:74145071-74145093 ATGGAAAATAAAGAAACTGCAGG - Intergenic
1010895637 6:81359366-81359388 TTGGCATATAAAGCTGCAGGTGG + Intergenic
1011085766 6:83538692-83538714 TAAGAACATAAAGATGCTGATGG - Intergenic
1013874651 6:114809586-114809608 TTTGAATATGAATATGCTGTAGG + Intergenic
1013953339 6:115811542-115811564 TTTGAAGATTAAGATGATGCTGG - Intergenic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1014998447 6:128183508-128183530 TTGATATATAAATATGATGCTGG + Intronic
1015240928 6:131022424-131022446 TTTGAATATAAAGCTGGTGGAGG - Intronic
1015840794 6:137474862-137474884 TTGGACTAAAAAGATACTGTTGG - Intergenic
1016291045 6:142528284-142528306 TTGGAAAATCAAGATGAAGCAGG - Intergenic
1016402624 6:143696916-143696938 TTGGAATAAAAACTTGTTGCTGG + Intronic
1016673330 6:146733716-146733738 TTAGAATGTAAATATTCTGCAGG - Intronic
1016843794 6:148550665-148550687 TTGCAATGTAATGAAGCTGCAGG + Exonic
1017657616 6:156645249-156645271 ATGGAATGTAAAGAGGCTCCAGG + Intergenic
1021046448 7:15928591-15928613 TAGGTATATAAAAATGCTCCTGG - Intergenic
1021380799 7:19963546-19963568 GTTGAATATAATGATTCTGCTGG - Intergenic
1021630956 7:22646915-22646937 TTGGAACTTAAAGTTGATGCTGG - Intergenic
1022455762 7:30556928-30556950 TTGGAATACAAAGATGCAAAAGG - Intergenic
1022561519 7:31354508-31354530 TTGGTATATGAAGATAGTGCTGG - Intergenic
1022966771 7:35481443-35481465 TAGAAATAGAAAGATGCTGAAGG - Intergenic
1023195245 7:37630429-37630451 TTGGAGTATAGAAATGCTACTGG + Intergenic
1024360536 7:48463157-48463179 ATGAAAAATAAAGGTGCTGCAGG - Intronic
1024908339 7:54415080-54415102 TTAGTATATAAAAATGCTACTGG - Intergenic
1025224684 7:57147317-57147339 TTAAAATTTCAAGATGCTGCAGG - Intergenic
1027613967 7:80398667-80398689 TTTAAATTTAAGGATGCTGCAGG - Intronic
1027748657 7:82111742-82111764 TTGGAATAGAAAGCTCCTCCTGG - Intronic
1027826477 7:83122819-83122841 TTGGCATATAGAAATGCTACTGG - Intronic
1027921506 7:84401195-84401217 TTGGCATATAGAAATGCTGCTGG - Intronic
1028521589 7:91737450-91737472 TTGGCATATAGAAATGCTACTGG + Intronic
1028551917 7:92077842-92077864 TTGTAATTTTAAGTTGCTGCTGG - Exonic
1029071736 7:97905037-97905059 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1029233671 7:99093447-99093469 CTGGAAAATAAAGATTCTCCTGG + Intronic
1029963277 7:104710805-104710827 TAGGAAAATGAAGATACTGCTGG + Intronic
1029973341 7:104810743-104810765 TTGGAATATATTGAAGCTGGAGG + Intronic
1032272920 7:130428125-130428147 TTAGAAATTAAAGATGGTGCCGG + Intronic
1032612820 7:133434118-133434140 TTGGCATCTAATGATGCTGAAGG - Intronic
1032912802 7:136453019-136453041 TTGGTGTATAGAAATGCTGCTGG + Intergenic
1033945051 7:146706299-146706321 TTGGGCTATAAAGTTGCTGAGGG - Intronic
1034058122 7:148058318-148058340 CTGGCATAAACAGATGCTGCTGG - Intronic
1034437165 7:151068204-151068226 TGAGAATATCAAGAAGCTGCTGG - Intronic
1036245965 8:7116957-7116979 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1036254830 8:7197505-7197527 TTGGTATGTAAGTATGCTGCAGG - Intergenic
1036888305 8:12577070-12577092 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1036895900 8:12635170-12635192 TTGGTATGTAAGTATGCTGCAGG - Intergenic
1037029590 8:14087641-14087663 TTGTAACATAAAGATGGTACTGG + Intergenic
1037136542 8:15469544-15469566 TGGGAATACAAAAATGGTGCAGG + Intronic
1038849997 8:31266383-31266405 TTTGTATATAAAGATCCTGATGG + Intergenic
1038974416 8:32677341-32677363 TTGTAAAATAAAGATTCTGAAGG - Intronic
1041854954 8:62441110-62441132 TTTGAATATAAATATTCTCCAGG + Intronic
1042044897 8:64639341-64639363 TTGAAATATATAGATGCTGATGG + Intronic
1042060526 8:64812046-64812068 ATGGAAGATAGAGATGCTGAGGG - Intergenic
1042224488 8:66504841-66504863 TTTAAAAATAAAGAAGCTGCTGG - Intronic
1042301244 8:67284910-67284932 TTGGAACAGAAAGATGTTCCAGG - Intronic
1042928468 8:73990522-73990544 TGGGAATCTAATGCTGCTGCTGG - Intergenic
1043292167 8:78616278-78616300 TTGGAATATGAAGATGCTGTTGG + Intergenic
1043645950 8:82518798-82518820 TTGGATTTTAAAGATGCTTTTGG - Intergenic
1044602037 8:94014983-94015005 TTTGAATATGAATATGCTACAGG - Intergenic
1045030272 8:98128294-98128316 TTGGAGAATAAACAGGCTGCTGG - Intronic
1045117353 8:98997818-98997840 TAGCAGTAGAAAGATGCTGCAGG - Intergenic
1045513171 8:102831130-102831152 TTGGTATATCAAGATGTTCCAGG - Intronic
1046584033 8:116129583-116129605 TTGGAATATAAAGATGGAAAGGG + Intergenic
1049138427 8:140928033-140928055 TTGGAATATAGATATGATGAGGG - Intronic
1050251477 9:3749380-3749402 TGGGAATATACATTTGCTGCTGG + Intergenic
1050316456 9:4406632-4406654 TTGGCATATAGAAATGCTACTGG - Intergenic
1050475597 9:6037427-6037449 TTGGAAAATAAATATATTGCTGG + Intergenic
1050531769 9:6596767-6596789 TTAGAATATTCATATGCTGCTGG + Intronic
1051541493 9:18224606-18224628 TTGGACTTTAAAGTTGATGCTGG - Intergenic
1051643724 9:19247900-19247922 TTTGAAGGTAAAGCTGCTGCTGG - Intronic
1053930900 9:43112901-43112923 TTGGAAAATCAGGAGGCTGCTGG - Intergenic
1058236001 9:102490885-102490907 TTGGTGTATAGACATGCTGCTGG - Intergenic
1060777731 9:126388645-126388667 TTGGAATCTAAGGACACTGCTGG - Intronic
1061756160 9:132813956-132813978 TTGGTATATAAAAATACTGTGGG - Intronic
1187323827 X:18268017-18268039 TTAGAACATTAAGATGCTACTGG + Intronic
1188880471 X:35486053-35486075 TTGGTATATAGATATGCTACTGG - Intergenic
1189878199 X:45459225-45459247 TTGGTGTATAGAAATGCTGCTGG + Intergenic
1190136447 X:47803772-47803794 TTGGAAGAAGAAGATGCTGCAGG + Intergenic
1192814784 X:74579047-74579069 TTTAAATATATAGATGCTTCTGG + Intergenic
1192823440 X:74668491-74668513 TTGGAATTTAAATCTGCTGCAGG + Intergenic
1193573169 X:83170212-83170234 TTGGCATATAGAAATGCTACTGG + Intergenic
1193629641 X:83867131-83867153 ATGGATTTTAAAGATGTTGCTGG - Intronic
1193639576 X:83995436-83995458 CTGGAATAAAAAGTTGCTGCTGG - Intergenic
1194898697 X:99479279-99479301 TTGGAACATAAAAATGCTACTGG - Intergenic
1195146213 X:102019573-102019595 TTGGACTTTAAAGTTGATGCTGG + Intergenic
1196071370 X:111526712-111526734 TTGAATTATAAAAATGCTACAGG + Intergenic
1196217108 X:113066318-113066340 TTGGCATATAGAAATGCTACCGG + Intergenic
1196561156 X:117150302-117150324 TTGGTATATAGAAATGCTACTGG + Intergenic
1197109775 X:122758580-122758602 TTGGTGTATAGAAATGCTGCTGG + Intergenic
1197397086 X:125940339-125940361 TTGGGACAAAAAGATGCTTCAGG + Intergenic
1198074746 X:133183620-133183642 TGGGCTTAGAAAGATGCTGCAGG + Intergenic
1198872739 X:141193360-141193382 TTGCAATATAAAGAGACTGGTGG + Intergenic
1199061645 X:143362574-143362596 TTGGCATATACAAATGCTACTGG + Intergenic
1199083082 X:143598121-143598143 TTGGAATATAAAGTTTGTGTGGG + Intergenic
1199362371 X:146937170-146937192 TTGGCATATAGAAATGCTACTGG + Intergenic
1199454066 X:148008102-148008124 TGGGAATAACCAGATGCTGCAGG - Intronic