ID: 920125514

View in Genome Browser
Species Human (GRCh38)
Location 1:203691124-203691146
Sequence TAGCTAAGGCTTCCCCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920125511_920125514 11 Left 920125511 1:203691090-203691112 CCAGCTGGGGTCAGAGGGATCTT 0: 1
1: 0
2: 0
3: 19
4: 224
Right 920125514 1:203691124-203691146 TAGCTAAGGCTTCCCCAACCTGG 0: 1
1: 0
2: 1
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920125514 Original CRISPR TAGCTAAGGCTTCCCCAACC TGG Intronic
900488247 1:2933612-2933634 CAGCTTAGGCTTCCCCAGCACGG - Intergenic
902310036 1:15575151-15575173 TGGGTAAGGCTTCCCCAAGGTGG + Intronic
912732874 1:112125216-112125238 TAACTAAAGCTTGCCCTACCAGG + Intergenic
913568038 1:120092408-120092430 TTGCTAATGCTTCACCAAGCTGG - Intergenic
914288847 1:146253429-146253451 TTGCTAATGCTTCACCAAGCTGG - Intergenic
914549882 1:148704173-148704195 TTGCTAATGCTTCACCAAGCTGG - Intergenic
914616857 1:149367855-149367877 TTGCTAATGCTTCACCAAGCTGG + Intergenic
920125514 1:203691124-203691146 TAGCTAAGGCTTCCCCAACCTGG + Intronic
921635763 1:217490412-217490434 TCGCTAAGAATTCCCCAACCTGG - Intronic
922765868 1:228156577-228156599 CAGCTGAGGCCTCCCCACCCGGG - Intronic
922864878 1:228851426-228851448 TAGCAAAGGATGCCTCAACCTGG + Intergenic
1063813678 10:9745190-9745212 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1065573299 10:27094172-27094194 TTCCTGAGGCCTCCCCAACCAGG + Intronic
1068697989 10:59989626-59989648 TAGCAAAGCCTTCCCCTCCCCGG - Intergenic
1078728727 11:13956649-13956671 TAGCTAAGTCTTCCCCATCCTGG - Intergenic
1079401850 11:20112319-20112341 TTGCTAAGTCTTCCTTAACCTGG - Intronic
1081458565 11:43249660-43249682 TAGCAATGGCTTCCCTTACCTGG + Intergenic
1081756185 11:45546387-45546409 TAGCTAAAGCATCCCCTGCCAGG + Intergenic
1081840187 11:46194728-46194750 TAGCTAAGGAGTCACAAACCAGG + Intergenic
1089117651 11:116109173-116109195 TAGCCAAGGCATCTCCAACATGG + Intergenic
1089188358 11:116636429-116636451 TTGCTCTGCCTTCCCCAACCGGG + Intergenic
1090920983 11:131205562-131205584 TAGCTCAGGGTTCCTAAACCAGG - Intergenic
1091182372 11:133618508-133618530 TACCTGAGGGTTCCCCAGCCTGG - Intergenic
1102583397 12:113906724-113906746 TAGGTAAGGCTCCTCCAAGCAGG - Intronic
1104458106 12:128932155-128932177 GAGCTAAAGCTTCCCCAGACGGG - Intronic
1104742136 12:131185375-131185397 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1104992574 12:132634445-132634467 CAGCGAAGGCTCCTCCAACCTGG + Intronic
1106792908 13:33174170-33174192 TATCTATGGTTTCCCCAACCAGG - Intronic
1107020362 13:35744898-35744920 TAGCAAAGGCTTCACCAAGAAGG + Intergenic
1117657806 14:57974238-57974260 TACCCAAGGCCTCCCCAACATGG + Intronic
1123208620 14:106737683-106737705 TAGCTTAGGCCACCCCACCCTGG + Intergenic
1125355857 15:38816858-38816880 TAGGGAAGGCCTCCACAACCTGG + Intergenic
1126514704 15:49521482-49521504 TAGCCAAGGCTTTCCCCACTGGG + Intronic
1131588888 15:93726933-93726955 GAGCTAGTGCTTACCCAACCAGG - Intergenic
1132500379 16:282276-282298 TAGCTGAGGTTTCCCCAATAGGG + Exonic
1138542297 16:57695836-57695858 AAGCCAGGGTTTCCCCAACCAGG + Intronic
1141470998 16:84238421-84238443 TAGCAAAGGCCTCCCCAAATGGG - Intronic
1148601177 17:48895378-48895400 CAGCTGAGGCTTCCCCAAACGGG - Intronic
1154178502 18:12108287-12108309 TTCCTGAGGCTTCCCCAGCCAGG - Intronic
1159719258 18:71865916-71865938 TAGCTCAGAGGTCCCCAACCAGG + Intergenic
1161296428 19:3522780-3522802 TAGGTGAGGCTCCCCCAACCTGG - Intronic
1162403755 19:10461426-10461448 TAGCTAACCCCTCCCCAGCCCGG - Intronic
1162549210 19:11349188-11349210 TAGCTAAGGTCACCCCCACCCGG + Intronic
1162894589 19:13757674-13757696 TTGCTGAGGGTTCCCCAACTAGG - Intronic
1166911308 19:46160319-46160341 GAACTAAGCCTTCCCCACCCTGG + Intronic
1202708810 1_KI270714v1_random:5230-5252 TAGCCAAGGCATCTCCAGCCAGG + Intergenic
925084786 2:1099545-1099567 TGGTTAAGGCTTCCCCAGCCTGG - Intronic
927309928 2:21618617-21618639 TAGGTAAGGCTTAACCAGCCAGG + Intergenic
927893716 2:26768177-26768199 GAGTTAAGGCTTCCACAAGCTGG - Intronic
931868368 2:66434608-66434630 TAGCAGAGGCTTTCCCAACCTGG + Intronic
935678496 2:105616854-105616876 TGGCCAAGGATGCCCCAACCAGG + Intergenic
935793784 2:106619220-106619242 TATCTAACGCTTCCCTGACCAGG - Intergenic
939138348 2:138323555-138323577 TACCTTAGTCTTCCCCAACTTGG + Intergenic
941494280 2:166181247-166181269 CAGCTCACGCTCCCCCAACCAGG - Intergenic
943458816 2:188143516-188143538 CAGCTAAGTCTTCCCTAAACAGG - Intergenic
943722683 2:191221388-191221410 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
948767968 2:240233256-240233278 GAGCTCAGGCCTCCCCCACCTGG + Intergenic
1172323518 20:34016567-34016589 TAGATAAGTGTTTCCCAACCTGG - Intronic
1176967846 21:15231536-15231558 TAGCTCAAGCTTGTCCAACCAGG + Intergenic
1182083625 22:27546226-27546248 TACCTGAGGCCTCCCCAGCCGGG - Intergenic
1182680918 22:32079255-32079277 TAGCTAAGGTATTCCCAGCCTGG + Intronic
1184686936 22:46100492-46100514 CGGCTGAGGCTTCCCCATCCTGG - Intronic
949860553 3:8501331-8501353 TGGCTAACGTTTCCCAAACCTGG - Intergenic
950444496 3:13028513-13028535 TTGCTAAGGTGACCCCAACCGGG + Intronic
952267045 3:31796808-31796830 TACCTTAGGCTTCCCCACACAGG + Intronic
953582165 3:44167099-44167121 CAGCAAAGGCTTCCCCAAGGAGG + Intergenic
958539137 3:95447576-95447598 TATCTTAGGTTTCCCCAACCAGG + Intergenic
958604663 3:96341293-96341315 TTTCTAAGGCCTCCCCAGCCAGG + Intergenic
960078433 3:113514935-113514957 GAAGTAAGGATTCCCCAACCGGG + Exonic
964809709 3:160650879-160650901 TAGCTTAGGCCTCTCCCACCTGG - Intergenic
964842142 3:161005897-161005919 TAGGAAAGCCTTCCCCACCCTGG - Intronic
965846402 3:172967569-172967591 TAGCTCAGAGATCCCCAACCAGG + Intronic
972995074 4:44869853-44869875 CAGCTCATGCTTCCCCAACCAGG + Intergenic
974967730 4:68783616-68783638 TTCTTAAGCCTTCCCCAACCCGG - Intergenic
975685030 4:76912033-76912055 TAGCTATGTCTCTCCCAACCTGG - Intergenic
977492345 4:97731521-97731543 AAGCTCATGCTTCCCCAACCAGG + Intronic
978821901 4:112976491-112976513 TAGCTAAAAATTCCACAACCAGG - Intronic
980318731 4:131239989-131240011 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
984302373 4:177938460-177938482 TAGCTACAGCTTCCTCAACAGGG - Intronic
985881525 5:2642088-2642110 TCTCTAGGGCTTCTCCAACCTGG + Intergenic
985971141 5:3379503-3379525 TTGCTCGGGCTGCCCCAACCAGG + Intergenic
986093557 5:4534841-4534863 TTCCTGAGGCCTCCCCAACCAGG - Intergenic
990799838 5:59588009-59588031 TAAACAAGGCTTCCCCACCCCGG - Intronic
991163436 5:63532718-63532740 TAGTTAAAGTTTCCCTAACCTGG - Intergenic
995179786 5:109220031-109220053 GAGCCAAGGCTTTCCCAACCTGG - Intergenic
998166478 5:139847305-139847327 TAGCCAGGGCTTCCCCATTCGGG + Intronic
998413063 5:141925525-141925547 TGGGTAAGGCTTCCCCAGCCTGG + Exonic
998429403 5:142057839-142057861 GAGCCAAAGTTTCCCCAACCTGG + Intergenic
999082914 5:148861177-148861199 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
999516289 5:152304885-152304907 TAGCTCAGGGTTCCCCAACATGG + Intergenic
1004005184 6:11631751-11631773 TGGCAAAGATTTCCCCAACCTGG - Intergenic
1004802015 6:19158935-19158957 GAGCTAAGGCTTCCCAAAATTGG - Intergenic
1005499447 6:26417330-26417352 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG + Intronic
1007680028 6:43627671-43627693 TACCTGAGGCTTCCCCTCCCAGG + Intronic
1016391244 6:143578230-143578252 TGGCTATGACTTCCCCATCCTGG - Intronic
1021030251 7:15724083-15724105 TAGCTTATGCTTCTCAAACCTGG + Intergenic
1026426497 7:70299685-70299707 TAGCTCAGGGTTTCCAAACCTGG + Intronic
1036271316 8:7305836-7305858 TAGCTTAGCTTTCCCCAATCGGG - Intergenic
1036350033 8:8004507-8004529 TAGCTTAGCTTTCCCCAATCGGG + Intergenic
1036757825 8:11483111-11483133 TTTCTGAGGCTTCCCCAGCCAGG - Intergenic
1038178510 8:25203843-25203865 TAGCTAATGCCTCCACAACATGG - Intronic
1047594848 8:126368074-126368096 TTGCTGAGGCCTCCCCAGCCCGG - Intergenic
1049815253 8:144596209-144596231 TGGCTAAGGCCTCGCCACCCCGG + Intronic
1050643277 9:7692146-7692168 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
1056103854 9:83327532-83327554 CAGCAAGGGCTTCCCCACCCAGG + Intronic
1056120523 9:83483296-83483318 TTCCTAAGGCCTTCCCAACCAGG + Intronic
1056428345 9:86501437-86501459 TAGTTCAGGTTTCCCCACCCTGG + Intergenic
1056948258 9:91019535-91019557 TAGATAAGAATTCACCAACCAGG + Intergenic
1057896550 9:98913482-98913504 TAGCTCAGGATTCCCAAAGCAGG + Intergenic
1186057976 X:5671683-5671705 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1186899016 X:14033291-14033313 TAGCTATGGCTTCCCACAGCTGG - Intergenic
1188265658 X:28070409-28070431 TAGCTAAGACTTCTCATACCAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1196393960 X:115239392-115239414 CAGCTAAGGCTTACTCAGCCTGG - Intergenic