ID: 920129535

View in Genome Browser
Species Human (GRCh38)
Location 1:203721190-203721212
Sequence CTTTCAATGGGGAATCCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920129535_920129542 10 Left 920129535 1:203721190-203721212 CCGCCAGGATTCCCCATTGAAAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 920129542 1:203721223-203721245 GTTGTGGGTTAATCTGATCATGG 0: 1
1: 0
2: 0
3: 5
4: 112
920129535_920129540 -6 Left 920129535 1:203721190-203721212 CCGCCAGGATTCCCCATTGAAAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 920129540 1:203721207-203721229 TGAAAGCTGTGCAGATGTTGTGG 0: 1
1: 0
2: 4
3: 22
4: 247
920129535_920129541 -5 Left 920129535 1:203721190-203721212 CCGCCAGGATTCCCCATTGAAAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 920129541 1:203721208-203721230 GAAAGCTGTGCAGATGTTGTGGG 0: 1
1: 0
2: 2
3: 28
4: 889
920129535_920129543 28 Left 920129535 1:203721190-203721212 CCGCCAGGATTCCCCATTGAAAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 920129543 1:203721241-203721263 CATGGACACTTTTGCTTCATTGG 0: 1
1: 1
2: 2
3: 10
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920129535 Original CRISPR CTTTCAATGGGGAATCCTGG CGG (reversed) Exonic
903995966 1:27305775-27305797 CTCTCAATGGGGAAGCCTATAGG - Intronic
904814006 1:33181855-33181877 CTGGGGATGGGGAATCCTGGGGG + Intronic
905819562 1:40979371-40979393 CTTTCACTGTGGGCTCCTGGCGG - Exonic
906060614 1:42946169-42946191 CTGTCAATGGGGGCTGCTGGAGG + Intronic
908652615 1:66352423-66352445 CTTTCAATATGGAATCAGGGAGG - Intronic
909658120 1:78053434-78053456 CACTCTATGGGAAATCCTGGGGG - Intronic
909746258 1:79100546-79100568 CTTTCAGTGTGAAAACCTGGAGG + Intergenic
911051171 1:93672742-93672764 CATTCCTTGGGGTATCCTGGGGG - Intronic
911417177 1:97589337-97589359 CTGTCAAGGGAGAATCATGGGGG + Intronic
914086027 1:144455353-144455375 CTGTTAATGGGAAATACTGGTGG - Intronic
920129535 1:203721190-203721212 CTTTCAATGGGGAATCCTGGCGG - Exonic
920591865 1:207227642-207227664 GTTTAAATGAGGAATCCTGTGGG + Intergenic
921917839 1:220632775-220632797 CTTTCAATTGGGAATTCTCAAGG + Intronic
923658592 1:235939653-235939675 CTTTCTATGAGGAACCCTGGTGG + Intergenic
1068680354 10:59812785-59812807 TTTTCAATGAAGAATCCTGCAGG - Exonic
1071020137 10:81044285-81044307 CTTTCAATGAGAGATCCTGAGGG - Intergenic
1074895353 10:117772737-117772759 CTTTCTATGAGGATTCATGGGGG + Intergenic
1077647722 11:3940652-3940674 CTTTCAAGGAGCCATCCTGGAGG + Intronic
1079363152 11:19786676-19786698 CTTTCTTTGGGGAATCCAAGTGG + Intronic
1087724921 11:101705902-101705924 TTTTATAAGGGGAATCCTGGGGG - Intronic
1087842901 11:102938308-102938330 CTTTCAATGGGGCAGCTTTGGGG - Intergenic
1091181757 11:133611212-133611234 ATTTCATTGGTGAATCCTTGTGG + Intergenic
1091358817 11:134958283-134958305 CTTTCCCTGGGGAAGCATGGGGG + Intergenic
1095979345 12:47962371-47962393 CCTTCCATGGGGAGTCCTGCTGG - Intergenic
1100323748 12:93521641-93521663 CTTTCAATGGCCAGCCCTGGGGG + Intergenic
1101531160 12:105574837-105574859 CTCTCCATGGGGAATCCAAGAGG - Intergenic
1102762796 12:115403524-115403546 TTTCCATTGGTGAATCCTGGTGG + Intergenic
1102771879 12:115484583-115484605 CTTTCAAAGGCTCATCCTGGAGG - Intergenic
1107967729 13:45612777-45612799 ATTTCAATGGGGGATCAGGGAGG + Intronic
1109195988 13:59377810-59377832 CTTTCAATCGGGAGGCATGGGGG - Intergenic
1113447097 13:110377552-110377574 CTTTCCATGGGGAATCAGGAGGG + Intronic
1113661565 13:112109718-112109740 CTTTCAATGGGGCAGGTTGGGGG + Intergenic
1114525991 14:23366978-23367000 CTTTCAGTGGAAACTCCTGGTGG - Intergenic
1118529044 14:66681391-66681413 TTTTCAAGGAGGAATCCTGATGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121579156 14:95013769-95013791 ATTTCCCTGGGGAATCTTGGTGG - Intergenic
1126064887 15:44819214-44819236 CTTTTAAGGGGGAATTGTGGGGG - Intergenic
1126094947 15:45081373-45081395 CTTTTAAGGGGGAATTGTGGGGG + Intergenic
1126234734 15:46370302-46370324 TTTTGAATGGGATATCCTGGGGG + Intergenic
1128795189 15:70461657-70461679 GTCTCAATGAGGAACCCTGGAGG - Intergenic
1131642544 15:94307840-94307862 CTTTCGGTGGGGAATGTTGGAGG + Intronic
1132163117 15:99561909-99561931 ATTTAAGTGGGGAACCCTGGAGG - Intergenic
1132879429 16:2155404-2155426 CTGTCATTGGGCTATCCTGGCGG + Intergenic
1133661989 16:7927370-7927392 CTTTCAATGCTGAACTCTGGAGG + Intergenic
1137552916 16:49452881-49452903 CTTTGAATCGGGAATCAAGGCGG - Intergenic
1137706169 16:50537345-50537367 CTCTCCAGGGGGAACCCTGGGGG - Intergenic
1141423646 16:83932275-83932297 CTTTCCTTGTGGGATCCTGGAGG - Intronic
1143101490 17:4506980-4507002 CTTGCCCTGGGGAAGCCTGGGGG + Intronic
1144436633 17:15248288-15248310 CTCTCAACAGGTAATCCTGGGGG + Intronic
1146574526 17:33979493-33979515 CATTCAGTGTGGATTCCTGGGGG - Intronic
1146957502 17:36944636-36944658 TTTTCAAAGGGGAACCCTGATGG + Intergenic
1150646459 17:66981001-66981023 CTTTGCATGGTGAATACTGGAGG + Intronic
1153989120 18:10379586-10379608 CTTTCCATGCTGAATGCTGGGGG + Intergenic
1154496150 18:14962956-14962978 CTTTCCCTGGGGAAGCATGGGGG - Intergenic
1159486640 18:69068730-69068752 CTTTCAATGGGAAAAACTGATGG - Intergenic
1166959086 19:46487291-46487313 CTTGCAAGGGGCAATGCTGGGGG - Intronic
926298619 2:11586502-11586524 GTTGCAATGGGAAACCCTGGGGG + Intronic
933449934 2:82435780-82435802 CTTACAATGGAGAAACCGGGAGG - Intergenic
940738758 2:157482766-157482788 CTTTCAATGGCCAATCCTTGTGG - Intronic
943446570 2:187994503-187994525 GTTTCAATGAGGAAGCCTCGTGG + Intergenic
943980023 2:194538334-194538356 TTTACAATGGTGAAACCTGGAGG - Intergenic
947573676 2:231255713-231255735 CTTTGGTTGGTGAATCCTGGTGG + Intronic
1169838980 20:9913087-9913109 CTTTCAATGCGGCCTCCTGCTGG + Intergenic
1170988303 20:21278800-21278822 CTTCCAGTGGAGAAACCTGGTGG + Intergenic
1171092124 20:22295165-22295187 CTACCAATGGGGACTGCTGGTGG - Intergenic
1171774806 20:29355259-29355281 CTGTCTCTGGAGAATCCTGGGGG + Intergenic
1173024840 20:39298361-39298383 CTTTCAATGTGCAATCCAGCGGG + Intergenic
1176992928 21:15520939-15520961 CTTTCTCTGGGTAACCCTGGGGG - Intergenic
1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG + Intergenic
1180179449 21:46111503-46111525 CCTGCTCTGGGGAATCCTGGGGG + Exonic
1181422510 22:22811639-22811661 CTTTCAATGAGGAGTCCCAGAGG + Intronic
1182771237 22:32797825-32797847 GATTCCATGGGGAATCCTGTAGG - Intronic
1183660976 22:39220971-39220993 CCTTGATTGGGAAATCCTGGAGG - Intergenic
1184223724 22:43116963-43116985 CTCTCACAGGGGAATCTTGGGGG + Intronic
1184607527 22:45582568-45582590 CTGTCACTGGGGAATCATTGAGG - Intronic
950201001 3:11043973-11043995 TTTGCAGTGGGGATTCCTGGCGG - Intergenic
961935596 3:130579478-130579500 ATAGCAATGTGGAATCCTGGGGG - Intronic
963989787 3:151639847-151639869 CCTTCACTGAGGAATCTTGGAGG + Intergenic
981393504 4:144219007-144219029 CTTTCAGTGGGGAATGATGAAGG - Intergenic
981506980 4:145512974-145512996 CTTTCAATGGAAGCTCCTGGAGG - Intronic
983827634 4:172284098-172284120 TTTTTAATGAAGAATCCTGGAGG - Intronic
984134275 4:175916149-175916171 GTTTCTATCGGGAACCCTGGGGG - Intronic
986821410 5:11470635-11470657 AATGCAATGTGGAATCCTGGAGG - Intronic
990109173 5:52302763-52302785 CTGTCAATGGGGAAGGCTGATGG + Intergenic
990443392 5:55869105-55869127 CAGCCAATGGGGAATCCAGGAGG - Intronic
994609157 5:102014152-102014174 ATGTTAATGGGAAATCCTGGTGG + Intergenic
998369421 5:141651315-141651337 CCCTGAATGGGGACTCCTGGCGG - Intronic
1002687303 5:181023908-181023930 ATATCAGTGGGGATTCCTGGGGG - Intergenic
1004379607 6:15120966-15120988 CTCTCAATGGGGCATCCTCATGG - Intergenic
1005840945 6:29744331-29744353 CTCTCCTCGGGGAATCCTGGTGG + Intergenic
1005870365 6:29970864-29970886 CTCTCCTTGGGGAATCCTGCAGG + Intergenic
1006072429 6:31507214-31507236 CTCTCCTTGGCGAATCCTGGTGG - Exonic
1007720305 6:43881237-43881259 CTTTCTATGGGGAATACTATTGG - Intergenic
1008807920 6:55454341-55454363 CTTTCAAAGGTGTATACTGGAGG + Intronic
1016380454 6:143473170-143473192 CTGGCAATGGGAAATCCTGCAGG - Intronic
1016785523 6:148006773-148006795 CTCTCAATGGAGAAACCTGGGGG + Intergenic
1019078589 6:169411803-169411825 CTCACACTGGGGACTCCTGGGGG - Intergenic
1019849218 7:3537883-3537905 TTTTCAGTGAGGCATCCTGGTGG + Intronic
1020456616 7:8380856-8380878 ATTTAGTTGGGGAATCCTGGTGG + Intergenic
1021199216 7:17709340-17709362 CTTTCACTGGGGAAGACTCGAGG - Intergenic
1021562802 7:21985905-21985927 CTTTCAAAGAGGTATCCTGGAGG - Intergenic
1021989330 7:26126925-26126947 CTTTCAATTCAGTATCCTGGGGG - Intergenic
1022991742 7:35715111-35715133 CTTTGACTCAGGAATCCTGGTGG + Intergenic
1025028750 7:55538751-55538773 CTTTCTAAGGGGAATGCTGTGGG + Intronic
1025034877 7:55587791-55587813 CTTTCTCTGGGGGATCATGGAGG - Intergenic
1027914262 7:84294941-84294963 CTGTCAGTGGAGAATGCTGGGGG + Intronic
1030698866 7:112616864-112616886 TATTCACTGGTGAATCCTGGGGG + Intergenic
1033453418 7:141481613-141481635 CTTTAAAAGGGGCATCCTGGAGG + Intergenic
1034718597 7:153266498-153266520 ATTTCACTGAGGTATCCTGGTGG - Intergenic
1035068725 7:156125699-156125721 TTTTCAATTGGGAATTTTGGCGG + Intergenic
1037669006 8:20998219-20998241 CTATCAATGGTGAATCCATGAGG + Intergenic
1038939050 8:32283858-32283880 CATCCAATGGGAAACCCTGGTGG - Intronic
1039070079 8:33641776-33641798 TTTCCAATGAGGAATCCTGAAGG + Intergenic
1039397132 8:37236107-37236129 CTTTCAATGGATTATACTGGGGG - Intergenic
1049449990 8:142655416-142655438 CTTTCCCTGGGCAGTCCTGGTGG - Intergenic
1052755538 9:32537208-32537230 CTTCCAATGTTGAATGCTGGTGG + Intergenic
1052833599 9:33234415-33234437 GTTTAAGTGGGGATTCCTGGAGG - Intronic
1058929930 9:109709099-109709121 CTCTCAAATGGGAATACTGGGGG + Intronic
1060666150 9:125433306-125433328 CTCTCATTGGGGATTCCTTGGGG - Intergenic
1060742407 9:126108239-126108261 GTTCCAAGGGGGAAGCCTGGAGG + Intergenic
1060821452 9:126663884-126663906 CTGTCTTTGGGGAATCCCGGGGG + Intronic
1061256889 9:129458776-129458798 CTTTGAATGTGGAAGCCTGGGGG + Intergenic
1061728565 9:132595606-132595628 CCTTCACTGTGGAACCCTGGAGG - Intronic
1188717108 X:33474002-33474024 CTTTATATGGGGAATCCTGAGGG - Intergenic
1188769636 X:34136323-34136345 CTTTTAGTGGAGAAGCCTGGCGG + Intergenic
1190285481 X:48958298-48958320 CGTTCAAGTTGGAATCCTGGAGG - Intronic
1190938525 X:55018261-55018283 TTTTTACTGGGCAATCCTGGTGG + Intronic
1191875748 X:65794254-65794276 CTGACAATGGGGAATGGTGGGGG + Intergenic
1192217617 X:69174110-69174132 CTTCCTCTTGGGAATCCTGGCGG - Intergenic
1199868107 X:151872481-151872503 CTTAAAATGGGGAATTCTGGAGG + Intergenic
1200965207 Y:9029060-9029082 CTTTCATTGGGGAATCCACAGGG - Intergenic
1201743851 Y:17350299-17350321 CTTTCAATAAGGAAAACTGGTGG + Intergenic
1202147903 Y:21819722-21819744 CTTTCATTGGGGAATCCACAGGG + Intergenic