ID: 920129988

View in Genome Browser
Species Human (GRCh38)
Location 1:203724651-203724673
Sequence ATTCTCATGAGGCAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920129988 Original CRISPR ATTCTCATGAGGCAGCAACC TGG Intronic
902829500 1:19001987-19002009 ATTGTCATGAGGCAGCAGCTGGG + Intergenic
906999641 1:50837439-50837461 CTAATCATGAGGAAGCAACCAGG - Intronic
908207351 1:61864557-61864579 AGTCTCAAGAGGCAAGAACCGGG + Exonic
909881293 1:80882220-80882242 ATTTCCATGAGGCAGAAACTTGG + Intergenic
910590071 1:88920642-88920664 ATTCTCATGTGTCAGTAACATGG + Intergenic
916911858 1:169358192-169358214 CTTCTCATTAGGCAGCAATCTGG + Intronic
917434620 1:175007871-175007893 ATTCACATTAGGCAGAAAACAGG - Intronic
917495722 1:175538476-175538498 ATTTTCTTTAGGCAGCAACTGGG + Intronic
919643763 1:200071093-200071115 ATTCTCGTTAGGCAGCCATCTGG - Intronic
920129988 1:203724651-203724673 ATTCTCATGAGGCAGCAACCTGG + Intronic
920734863 1:208524118-208524140 ATCCTCTTGAGGAAGCAACTGGG + Intergenic
921434674 1:215104514-215104536 ATGCACAGGAGGCAGCAAGCAGG - Intronic
922828591 1:228538800-228538822 ATTCTCATGAGAAAGACACCTGG - Intergenic
922829785 1:228546290-228546312 ATTCTAATGAGAGAGCATCCTGG - Intergenic
924275838 1:242385985-242386007 GCTCTCAGGAGGAAGCAACCTGG - Intronic
1064207672 10:13337893-13337915 TTTATCATGAGGCAGCCACGTGG - Intronic
1067794198 10:49308886-49308908 ATGCTGAGGAGGCATCAACCTGG + Intronic
1069196015 10:65552373-65552395 ATTCTCACGAGGTAGCAGCAAGG - Intergenic
1070924532 10:80210096-80210118 ATTCTAATTAGTCAGCAAACAGG + Intergenic
1071069857 10:81679499-81679521 TTTTTGCTGAGGCAGCAACCAGG - Intergenic
1073535599 10:104274397-104274419 ATTCTCATGATACAGCAACTAGG - Intronic
1074126569 10:110533305-110533327 ATTATCCTCAGGCAGCAAGCAGG + Intergenic
1074917217 10:117969008-117969030 ATACTTATGAAGCAACAACCAGG + Intergenic
1076197091 10:128526834-128526856 ATTGTGGGGAGGCAGCAACCAGG - Intergenic
1077102816 11:829718-829740 CATTTCATGAGGCAGCAGCCAGG + Intronic
1084399566 11:68935860-68935882 ATTCTCAGAAGGCAGAAAGCAGG + Intronic
1085153630 11:74272717-74272739 ATTCTAATGAGGCTGAAACAAGG + Intronic
1085341375 11:75733690-75733712 TTTCTCATGAGGTTGCAGCCAGG + Intergenic
1085696439 11:78708745-78708767 AATCTCAGGAGGCAGCAAGGTGG - Intronic
1086312851 11:85555069-85555091 ATTATCATGAGGCAGCCAAGTGG - Intronic
1086563959 11:88203018-88203040 ATTCTCTCAAGGCAGTAACCTGG - Intergenic
1087029860 11:93691981-93692003 ATCCTCAAGAAGCAGCAGCCAGG + Exonic
1088359842 11:108978510-108978532 ATTCTCCTGAGGCTCCATCCTGG - Intergenic
1089213500 11:116821704-116821726 ATTGGCATGGGGCAGCAGCCGGG + Exonic
1089779848 11:120866103-120866125 AGTCTCATGTGGCAGTGACCCGG - Intronic
1089845285 11:121453456-121453478 AGTCTCATGAGGCAATAACACGG - Intronic
1090748820 11:129728467-129728489 ATTCTCATGGAGAAGCAGCCAGG + Intergenic
1090916373 11:131167134-131167156 ATTCTCAATTAGCAGCAACCTGG - Intergenic
1090967849 11:131614185-131614207 CTTCTCATGATGCAGAAAACAGG + Intronic
1091421321 12:343192-343214 AATCTGCTGAGGCAGCAGCCTGG + Intronic
1091495318 12:967498-967520 ATTCTCAAGAAGCACCATCCTGG + Intronic
1096205902 12:49721685-49721707 ATTCCCATGTGGAAGGAACCTGG - Intronic
1097249832 12:57626471-57626493 ATTCTCATGGGGCAGGAAATGGG - Exonic
1097824753 12:64163517-64163539 CTTCTCTTGAGGCAGCAAATGGG - Intergenic
1098624169 12:72642025-72642047 ATTCTCACGTGGCAGAAACAGGG - Intronic
1106564175 13:30871006-30871028 ATGCTCATCAGTCAGCAAGCAGG - Intergenic
1107806312 13:44156999-44157021 ACTCTCAGGAGGCAGGAACTGGG + Intronic
1109678154 13:65708304-65708326 ATTCTCCTGACTCAGCCACCTGG + Intergenic
1114210115 14:20606926-20606948 ATGCACATGTGGCAGCACCCTGG - Intronic
1114497197 14:23140979-23141001 ATTTTCATGAAGAAGCATCCAGG + Intronic
1115266848 14:31509306-31509328 ATTCTCATGCCTCAGCAACATGG + Intronic
1117716354 14:58585651-58585673 AATCTCACGAGGCAGCAGTCAGG - Intergenic
1119294570 14:73522562-73522584 CTTCTCAGGAGGCAGAAGCCAGG + Exonic
1119565658 14:75627017-75627039 GTTCTCATGAGTCAGTGACCTGG - Intronic
1119707918 14:76798075-76798097 ATGCTCATGAACCAGGAACCAGG + Intronic
1119763796 14:77175218-77175240 ATACTCATGAGGCAGAAATATGG - Intronic
1120687667 14:87556768-87556790 ATTCTCATGCCTCAGCCACCTGG - Intergenic
1121983653 14:98477623-98477645 GTTCTCCTGAGGCAGCAGCCGGG + Intergenic
1130091092 15:80821986-80822008 AGTCTCAAGGTGCAGCAACCAGG - Intronic
1131376212 15:91925924-91925946 AGCCTGATGAGGCAGAAACCTGG - Intronic
1137853209 16:51767176-51767198 ACTCTCATCAGGCAGCTACTGGG - Intergenic
1138209897 16:55154804-55154826 ATTCTCATGTGGCAGAAAGAGGG + Intergenic
1143079496 17:4370809-4370831 ACTGTCATGAGGTAGGAACCTGG - Intergenic
1143783668 17:9241966-9241988 GTCCTCAAGAGGCAGTAACCAGG - Exonic
1149740755 17:59043673-59043695 ATTCTCATCATGCTGCATCCAGG - Intronic
1152043981 17:77923923-77923945 ATGCTTAGGAAGCAGCAACCAGG - Intergenic
1152272609 17:79333852-79333874 ATCCTCAAGAGGCATCATCCTGG + Intronic
1154151897 18:11912893-11912915 ATTCTCATGCCTCAGCATCCGGG + Intergenic
1154979704 18:21492628-21492650 ATTCTGATGAGCTAGCAGCCAGG - Intronic
1155548339 18:26938875-26938897 ATTCTTATAAGGCAGGAACAAGG - Intronic
1157552294 18:48590168-48590190 AGCCTCATGAGGCAGAAGCCTGG + Intronic
1158429868 18:57375649-57375671 ATTTTCCTGAAGCAGCATCCTGG - Intergenic
1164373037 19:27658114-27658136 ATTCTAATGAAACAGAAACCAGG - Intergenic
1164647052 19:29866236-29866258 TTTCTCAGGAGGCTGTAACCGGG - Intergenic
1165337191 19:35179383-35179405 ATTGGCATAAGGCAGCAACCAGG + Intergenic
1165610210 19:37144953-37144975 ACTCTCATGAGGTTGCAATCAGG - Intronic
1165992374 19:39823968-39823990 ATTCTCATGTCACAGCAAACTGG + Intergenic
1166300072 19:41908187-41908209 ATTCTGCTGAGGCAGGGACCAGG - Intronic
927262841 2:21111393-21111415 ATTCTCTTCAGGCAGTGACCTGG + Intergenic
927289770 2:21393972-21393994 ATTCTCATGTGGCAGAAAGAGGG + Intergenic
929138645 2:38648282-38648304 ACTGTCCTGATGCAGCAACCTGG + Intergenic
929512546 2:42576174-42576196 ATTCTAATGAGGGAGACACCCGG + Intronic
932479412 2:72029807-72029829 ATTCTCATCAGGGAGGAACAAGG + Intergenic
933692790 2:85192492-85192514 ATTCTCATGCGTCAGCCTCCTGG + Intronic
936097857 2:109547195-109547217 AGTCTCTAGAGGCAGCAACTTGG - Intronic
940157684 2:150676538-150676560 ATTCACTTGAGGCAGCCACAGGG + Intergenic
1168909387 20:1434980-1435002 ACTCTTATGAGGCAGCAGTCTGG + Intergenic
1169297566 20:4413191-4413213 ATCCTCATGAGAGAGCAACCAGG + Intergenic
1170873140 20:20226605-20226627 ATTCTCTTGGGGCTTCAACCTGG + Intronic
1174484794 20:50854422-50854444 ATTCACGTGAGGCAGGCACCCGG + Intronic
1178715818 21:34963387-34963409 ATCCTCACGTAGCAGCAACCTGG - Intronic
1180670251 22:17547680-17547702 ATTCTCGTGGAGCAGAAACCAGG + Intronic
1181665425 22:24392575-24392597 TTTATCATGAGGCAGCAACAGGG - Intronic
1183340936 22:37281034-37281056 TCACTGATGAGGCAGCAACCAGG + Intergenic
1185202169 22:49514267-49514289 CTTCACATGAGGCAGGGACCCGG - Intronic
949501310 3:4682753-4682775 TTTCTTATTAGCCAGCAACCAGG + Intronic
949658369 3:6248164-6248186 AATCTCAGGAGGCAGGAACAAGG - Intergenic
951392281 3:22121074-22121096 ATTCACAGTAGGCAACAACCAGG - Intronic
951574820 3:24102781-24102803 ATTCCCATGAGGAAGGGACCAGG - Intergenic
952799958 3:37281052-37281074 ATTCTCATTAGTTAACAACCGGG - Intronic
955029998 3:55206867-55206889 AATTTCAGGAGGCGGCAACCAGG + Intergenic
955182014 3:56681923-56681945 ATTCTCAAGAGTCACCAACTTGG - Intronic
955514986 3:59717534-59717556 ATTCTTATGGGGCAGAAACAAGG - Intergenic
957575454 3:82001623-82001645 ATTCTCATTAGGAAACAACAGGG - Intergenic
958948080 3:100387338-100387360 ATTCTCATGCCTCAGCCACCCGG - Intronic
968252828 3:197237576-197237598 ACTCTCATGAGGCTGTAACAAGG + Intronic
969283027 4:6184235-6184257 CTTCTCAATAGGCAGAAACCAGG + Intronic
973078227 4:45957463-45957485 ATTCTCATGACTCTGCAACTTGG + Intergenic
975215553 4:71750282-71750304 GTTCTCATAATGCAGCTACCTGG + Intronic
977480672 4:97570722-97570744 AGTCTGTTGAGGCAGCAACTTGG - Intronic
980561854 4:134487630-134487652 ATTATTATGAGGCTGCACCCTGG + Intergenic
980822691 4:138037786-138037808 ATTGTTGTGAGGCAGCAGCCAGG - Intergenic
981451035 4:144898098-144898120 ATTCTCAGTAGGCAGGAAGCAGG - Intergenic
981463246 4:145035478-145035500 ATTGTCATGGGGCAGGAGCCAGG + Intronic
981800851 4:148653824-148653846 ATTCTTATGAGTCAGCAAGATGG - Intergenic
982210013 4:153026811-153026833 ACTCTCATGAGGCTGTAACGAGG + Intergenic
982235374 4:153247170-153247192 GTTCTCATGAGAAAGAAACCTGG - Intronic
985755124 5:1709304-1709326 ATTCTCTTCAGGCAGGAAGCTGG - Intergenic
985987404 5:3527869-3527891 CTTCAGATGAGGCACCAACCTGG + Intergenic
986731100 5:10635723-10635745 ATACTGGTGAGGCAGCAGCCTGG + Intronic
987091691 5:14513349-14513371 ATTCTCATGAGCGTGCAACCTGG + Intronic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
990354614 5:54954180-54954202 ATTCTCCTGACTCAGCATCCTGG + Intergenic
991955947 5:71996186-71996208 TCTGTCATGAGGCAGCAAACAGG - Intergenic
992193373 5:74316130-74316152 ATTCCCATGAGTCAGCCCCCTGG - Intergenic
994581480 5:101648271-101648293 ATTCTCATGAGTACACAACCTGG + Intergenic
994810184 5:104507148-104507170 ATTCTCTTAAGGTAGTAACCTGG + Intergenic
996951054 5:129126846-129126868 ATTTTCCTTTGGCAGCAACCAGG - Intergenic
998413950 5:141931794-141931816 AAGCTCATGAGGGAGAAACCAGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002509009 5:179700530-179700552 ATTCTCATGATCCAGTTACCTGG - Intronic
1003702391 6:8482067-8482089 ATTCTCTTCAGGCAGTAACCTGG + Intergenic
1003953864 6:11144344-11144366 ATTCTCATTAGGCAGGAATAAGG - Intergenic
1004054464 6:12121636-12121658 ATTCTCATTAGTCTCCAACCTGG - Exonic
1004395531 6:15244696-15244718 TTTCTCAGGAGGCAGCCGCCGGG + Intergenic
1004453527 6:15769916-15769938 ATAAACATGAGGCAGCAAGCGGG + Intergenic
1004552617 6:16663607-16663629 ATGCTCATCACGCAGCAGCCAGG + Intronic
1005666980 6:28067662-28067684 ATTCCCATGAGGGAGGGACCTGG + Intergenic
1012860291 6:104551476-104551498 ATTCTCATTTGGCAGTAACAAGG + Intergenic
1013401435 6:109800674-109800696 ATGCTCATGGGGCCTCAACCAGG - Intronic
1015376991 6:132521857-132521879 ATTGTCATGATGCTGAAACCAGG - Intergenic
1016896333 6:149057000-149057022 AGTCTCAAGAGCCAACAACCTGG - Intronic
1018562620 6:165118160-165118182 CTAGTCAGGAGGCAGCAACCTGG + Intergenic
1021112715 7:16713813-16713835 ATTCTCATGAAGTAGCAGTCAGG - Intergenic
1024783786 7:52882871-52882893 GTTGACATGAGCCAGCAACCAGG + Intergenic
1025254487 7:57374331-57374353 ATTCTCATGGAGTTGCAACCTGG + Intergenic
1025977020 7:66377608-66377630 ATTATCAGGAGGCAGTAGCCTGG + Intronic
1029163675 7:98570946-98570968 ACTCCCATGAAGCAGCTACCTGG + Intergenic
1034762319 7:153684561-153684583 ATTCCCATGAGATAGCAGCCTGG - Intergenic
1035345962 7:158198594-158198616 ATGCTCCTGAGGCAGGAACAGGG - Intronic
1038714740 8:29981428-29981450 ACTCTCAGGAAGCAGCAGCCCGG + Intergenic
1039987023 8:42456349-42456371 AGTCTCTTAAGTCAGCAACCTGG + Intronic
1044135808 8:88584437-88584459 AACCTCATGGGGCATCAACCTGG + Intergenic
1050443294 9:5688312-5688334 ATTCTCACAAGGCAGTAAGCTGG + Intronic
1050831191 9:10015999-10016021 CTTCTCCTGAGGCAGGTACCAGG + Intronic
1051339138 9:16094917-16094939 ACCCTCATGAGACAGCAACGGGG - Intergenic
1051462648 9:17339698-17339720 ATTCTCATGAGGGAAGAAACTGG + Intronic
1055971423 9:81916176-81916198 CTTGTCATGAGGCTGCCACCAGG - Intergenic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1058620222 9:106874999-106875021 ATTATCATGAAGCAGCAATTGGG - Intronic
1058774243 9:108268270-108268292 ATTGTCTTGGGGCAGCAAGCAGG - Intergenic
1059644870 9:116254844-116254866 ATTATCCTGAGACAGCTACCAGG - Intronic
1059750458 9:117242641-117242663 ATTCTCAAGAGGAAGCAAGTGGG + Intronic
1186855230 X:13619913-13619935 TTTCTCATGAGGCAACAGCAGGG + Intronic
1191229495 X:58082869-58082891 ATTCTAATGAGACAGCCAGCTGG + Intergenic
1191246230 X:58230423-58230445 ATTCTAATGAGGGAGACACCTGG + Intergenic
1200242715 X:154506321-154506343 AGGCTCATGAAGCAGCCACCGGG + Exonic