ID: 920131966

View in Genome Browser
Species Human (GRCh38)
Location 1:203739144-203739166
Sequence CTCAATCATCTTTTTAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920131964_920131966 0 Left 920131964 1:203739121-203739143 CCTCAGCACAGAAATCCACATAT 0: 1
1: 0
2: 2
3: 28
4: 265
Right 920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG 0: 1
1: 0
2: 3
3: 29
4: 240
920131961_920131966 26 Left 920131961 1:203739095-203739117 CCATTCCACATTCACAAAATGTT 0: 1
1: 0
2: 1
3: 27
4: 309
Right 920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG 0: 1
1: 0
2: 3
3: 29
4: 240
920131963_920131966 21 Left 920131963 1:203739100-203739122 CCACATTCACAAAATGTTTGGCC 0: 1
1: 0
2: 1
3: 18
4: 146
Right 920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG 0: 1
1: 0
2: 3
3: 29
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920131966 Original CRISPR CTCAATCATCTTTTTAAGTT TGG Intronic
901254385 1:7808922-7808944 ATCGTTCATCTTTTTAATTTTGG - Exonic
906438909 1:45823076-45823098 TTCACTCTTCTTTTTATGTTTGG + Intronic
909137103 1:71815475-71815497 CTCAATTATCTGTTTAATATTGG + Intronic
909396312 1:75174440-75174462 CTCAATAATTTTTTTATGCTGGG + Intergenic
909653265 1:77999723-77999745 CACAATAATCTTTGTGAGTTAGG + Intronic
909742492 1:79047694-79047716 TTCAAAAATCTTTGTAAGTTAGG - Intergenic
909909275 1:81241884-81241906 CTTAATCATTTTTTTAATTTTGG + Intergenic
910023864 1:82625475-82625497 GTCAATCATGTTTTTAACTGTGG + Intergenic
910375669 1:86566936-86566958 CCCAAGCTTCATTTTAAGTTTGG - Intronic
911866512 1:103031762-103031784 CTCATTCATCTTTGTAGGTAGGG - Intronic
912189895 1:107325697-107325719 TTCAACCAGCTTTTTAAGTGTGG + Intronic
914902648 1:151719417-151719439 TTCAATAATCTTTTTATGTAGGG - Intronic
916679519 1:167091177-167091199 CACCATCATCTTTTTAAAATGGG + Intergenic
917210868 1:172630839-172630861 CTCAAGCTTCTTTTTATGTTGGG + Intergenic
918062044 1:181070395-181070417 CTCAATTATCTTTGTAAAGTTGG - Intergenic
919333251 1:196198649-196198671 CTCTCTCATCTTTTAAAATTGGG - Intergenic
920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG + Intronic
920199891 1:204253108-204253130 CTCATTGATATTTTTGAGTTTGG + Intronic
920714667 1:208328339-208328361 CTTAGTCATCTTTCTAACTTGGG + Intergenic
921085518 1:211787975-211787997 CTCAATTAACTTCTTAAATTTGG + Intronic
922030981 1:221797965-221797987 CACAATCAGGTTTTTAGGTTTGG - Intergenic
922411259 1:225378041-225378063 CTCAATTATCTCTTTTAATTGGG + Intronic
924445370 1:244124859-244124881 CTTATTCAGCTTTTTAAATTGGG - Intergenic
1063306415 10:4906027-4906049 CTCAATCATCTATTGATGGTGGG + Intergenic
1063396836 10:5696081-5696103 CTCAATCCTCATTTTCATTTAGG - Intronic
1063655073 10:7980213-7980235 CAGAATCATCTTTTGAAATTAGG + Intronic
1064842538 10:19611053-19611075 CTCAATCATCTTTCTATACTGGG - Intronic
1065299172 10:24305354-24305376 CTCAAGCTTCTTTTTATATTTGG + Intronic
1065479883 10:26182584-26182606 ATAAATAATTTTTTTAAGTTTGG + Intronic
1068527919 10:58152129-58152151 CTCAGACATCTTTCTAGGTTTGG + Intergenic
1069178247 10:65322488-65322510 CTCCATCATTTTTTAAACTTGGG - Intergenic
1069987439 10:72293936-72293958 CACAACCATCTTTTTTAGGTAGG - Intergenic
1070889742 10:79934151-79934173 CTTACTCATCTTGTTATGTTAGG + Intergenic
1071858564 10:89649811-89649833 CTAAACCATCTTTATAGGTTAGG - Intergenic
1074915813 10:117953880-117953902 CTCAATCTTCTTTTTAAGGAAGG - Intergenic
1075208751 10:120472168-120472190 CTCAATGTTCTTTATCAGTTCGG + Intronic
1075346512 10:121685935-121685957 CTCAATAATCATCCTAAGTTTGG - Intergenic
1077848214 11:6048539-6048561 CACAATCCTCTTTTTAACATAGG - Intergenic
1081226199 11:40525578-40525600 TTCAATCATGGTTTTCAGTTTGG - Intronic
1081285900 11:41269817-41269839 CACAGTAATCTTTTAAAGTTTGG - Intronic
1082948399 11:58785701-58785723 CTCAAGCATCATTTTAAATTTGG + Intergenic
1084119132 11:67058846-67058868 GTCATACATTTTTTTAAGTTGGG + Intronic
1085364768 11:75929560-75929582 CTCAGTCATATTTTTATTTTGGG + Intronic
1085687545 11:78637852-78637874 TTCATTCTTCTTTATAAGTTTGG - Intergenic
1085795639 11:79537111-79537133 CACCATCATATTTTTAAGTTAGG + Intergenic
1087146211 11:94814133-94814155 CTCCATCATCTTTTTATGTCAGG + Intronic
1087708072 11:101518009-101518031 CTCAAACAACTTTTTAATCTAGG - Intronic
1089125594 11:116174458-116174480 CTCAATCATTCTTTGAAATTTGG - Intergenic
1091712528 12:2752207-2752229 CTGAAAGATTTTTTTAAGTTAGG - Intergenic
1092912139 12:13155293-13155315 TTTAAAAATCTTTTTAAGTTTGG - Intergenic
1093831265 12:23761805-23761827 CTCGATAATCTGTTTAAATTAGG + Intronic
1094196747 12:27757736-27757758 CTCTATCATCTTTTGCAGTTTGG + Intergenic
1096009878 12:48203824-48203846 CCCATTCATCATTTTAAATTAGG - Intergenic
1097024081 12:56041489-56041511 CTCATTCATCTTTTTATCTCTGG - Intergenic
1097074160 12:56380088-56380110 CTTCATCAACTTTTTCAGTTGGG + Intergenic
1097460265 12:59853630-59853652 CTGTATAATCTTTTTGAGTTTGG + Intergenic
1097889529 12:64763572-64763594 CTCATTCATCTTTATCACTTTGG + Intergenic
1098068389 12:66644491-66644513 TTCAATCTTCTTTTGAGGTTTGG - Intronic
1101220118 12:102630132-102630154 CTCAGTCTTTTTTTTAAATTTGG + Intergenic
1101265370 12:103079573-103079595 CTGAGTCATCTTTGTCAGTTAGG + Intergenic
1106838797 13:33664609-33664631 GTCAATAGTTTTTTTAAGTTCGG - Intergenic
1107091021 13:36479737-36479759 CTCAATTAAATTTTTCAGTTTGG - Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1109767571 13:66924439-66924461 TTCAATCATCTTTTTAAATTAGG + Intronic
1110894708 13:80734709-80734731 ATTAATCATTTTTTGAAGTTTGG - Intergenic
1115429597 14:33300910-33300932 CTCAATCCTATTTCTAAGCTTGG - Intronic
1116659254 14:47687553-47687575 TTAGTTCATCTTTTTAAGTTTGG + Intergenic
1117865204 14:60141018-60141040 CTCTTTCATCTTTATAAGTAGGG - Exonic
1118677708 14:68206420-68206442 TTCAGTCATCTTATAAAGTTTGG - Intronic
1119334790 14:73823890-73823912 TTCATTGATCTTTGTAAGTTGGG + Intergenic
1120016801 14:79483117-79483139 CTCAATCTTTTATTTAAGCTAGG + Intronic
1121231030 14:92358571-92358593 CTCAATGATCATGTTAAGTTGGG - Intronic
1124903724 15:33848438-33848460 CTCCATCTCCTTTTTAGGTTGGG - Intronic
1125160075 15:36632775-36632797 ATCAGTCATCTTTTTAAATGTGG - Intronic
1128043435 15:64595550-64595572 CTAAATTCTCTTTTTAAGTCAGG + Intronic
1129481734 15:75831906-75831928 TTAAATCATCTCTTTATGTTGGG - Intergenic
1131274182 15:90966981-90967003 CTCATTCACATCTTTAAGTTAGG + Exonic
1131639875 15:94281109-94281131 CTCAAATATCTTTCTTAGTTTGG + Intronic
1131857121 15:96609420-96609442 TTTAATTATCTTTTTAACTTTGG - Intergenic
1131891481 15:96976457-96976479 ACCAAACATCTTTTTAATTTTGG - Intergenic
1133645205 16:7757704-7757726 CTCAATTGTCTTTTCATGTTAGG - Intergenic
1134433045 16:14229437-14229459 GTCAATAATGTTTTTAATTTAGG - Intronic
1138864802 16:60803731-60803753 CTAAATCAACATTTTAACTTAGG - Intergenic
1139874527 16:70134827-70134849 CTCTTTCATCTTTTTAAATTTGG - Intronic
1140309251 16:73833350-73833372 CTAAATAATTTTTTTAAGCTGGG - Intergenic
1144190856 17:12844159-12844181 CTCACTCATCTTTTTCTCTTAGG + Intronic
1149635035 17:58160042-58160064 CTGCATCATCTTCTTAACTTTGG - Intergenic
1149744285 17:59080150-59080172 CACAAACTTCATTTTAAGTTAGG + Intronic
1149926997 17:60711277-60711299 CTCAATGTTCTTTGTAATTTTGG + Intronic
1151513189 17:74574823-74574845 CTCAAGCTTCTTTTTATATTGGG + Intergenic
1157267463 18:46239812-46239834 GTCCATCATCTTTGTAAGCTTGG + Intronic
1158397212 18:57088741-57088763 CTCCATCATCTTATTTTGTTGGG + Intergenic
1158662745 18:59403711-59403733 CTAAATCATATTTTTAAATGGGG - Intergenic
1159101777 18:63966237-63966259 CTCAGTAATCTTTTGAATTTAGG + Intronic
1159226629 18:65545987-65546009 TTCAAACATTTTCTTAAGTTGGG + Intergenic
1159230702 18:65604983-65605005 CTGAATCATATATTTCAGTTGGG - Intergenic
1165615432 19:37195718-37195740 CTAATTCTTCTTTGTAAGTTTGG - Intronic
925034569 2:675932-675954 CAGAATCATGTTTTTAAGGTGGG + Intronic
926586007 2:14686470-14686492 CTCAAGCTTCTTTTTATTTTTGG + Intergenic
926766397 2:16326061-16326083 CCCAATCATCTTGTAAAATTTGG - Intergenic
927094051 2:19734411-19734433 CTTACTCATCTTTTTGACTTGGG - Intergenic
928043434 2:27902244-27902266 CTCATTCATTTTTTAATGTTGGG - Intronic
928238235 2:29563988-29564010 CTCAAGCTTCTTTTTATATTGGG - Intronic
929290048 2:40180107-40180129 CACAATCATCTTTTAAAGAGTGG + Intronic
929641342 2:43582960-43582982 CTCCCTGATCTTTTTATGTTAGG + Intronic
929698782 2:44143479-44143501 CTCAAACATATTTTCAAGCTTGG + Intergenic
929979557 2:46665914-46665936 CTCAATCCTTTTTTGAAATTTGG + Intergenic
930406566 2:50964862-50964884 CTCAATATTCTTTTTAAATCAGG + Intronic
930502131 2:52234682-52234704 CTGAATCATATGTTTAAGTGAGG - Intergenic
932507513 2:72250164-72250186 TTCAATCATTTTTATAATTTGGG + Intronic
932531173 2:72534758-72534780 CTCAGTGATCTTTGTAACTTTGG - Intronic
933053108 2:77625963-77625985 GTCTATCATTTTTTTAAGTACGG + Intergenic
933101132 2:78259250-78259272 CTCAATTATCTTTTTAATGTAGG + Intergenic
933331065 2:80893797-80893819 CTCAATCTTTTTTTGGAGTTAGG - Intergenic
933614169 2:84466819-84466841 GTCAATCATGTTTTTAACTGTGG - Intergenic
933632887 2:84676410-84676432 CTCATTCATTTTTTTCAGTAAGG - Intronic
933867943 2:86540814-86540836 TTCAATCATCTTTTTTTGTGGGG + Intronic
935847375 2:107181458-107181480 CACATTCATCTTTATAATTTAGG - Intergenic
935887562 2:107638779-107638801 CCTAATAATCTTTTTAACTTAGG - Intergenic
936801312 2:116269715-116269737 CTTAATCATGTGATTAAGTTCGG + Intergenic
936930712 2:117785792-117785814 CTCAGTCCTCATTTAAAGTTTGG - Intergenic
937945844 2:127335450-127335472 CTCAATTAGCTTATTATGTTTGG - Intronic
938205743 2:129421350-129421372 CTTTATCATGTTTTTAAGTGTGG - Intergenic
941755113 2:169176732-169176754 CTCTATCATCTGTTTTATTTAGG - Intronic
943042274 2:182817904-182817926 CTTAATTATATTTTTAAGATTGG - Intergenic
943875984 2:193068124-193068146 CTTCATCATCTTTTTCAATTTGG + Intergenic
946169225 2:217884589-217884611 CTCAAAAATCTTGTTGAGTTGGG - Intronic
946976791 2:225162054-225162076 CTCATTTAATTTTTTAAGTTTGG + Intergenic
947304708 2:228731340-228731362 ATCTTTCATCTTTTTAAGATAGG + Intergenic
947725604 2:232397773-232397795 TTCAATCATATTTTTAAGAATGG + Intergenic
1169785827 20:9358340-9358362 CTCCTTCATCTTTTGATGTTTGG - Intronic
1174957324 20:55113717-55113739 CTCACTGATCTTTCTGAGTTTGG + Intergenic
1178220079 21:30646159-30646181 CTCACTCATCTGTTTATTTTAGG - Intergenic
1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG + Intergenic
1179061068 21:37979973-37979995 CTCAATCATTTTATTTTGTTTGG - Intronic
1179558842 21:42199694-42199716 CTGAATCATCATTTGTAGTTTGG + Intronic
1179604184 21:42502199-42502221 CTCATTCATCTATTTACTTTGGG - Intronic
1182005675 22:26957443-26957465 CTTAATCACTTTTTTAAGTGTGG + Intergenic
1182163134 22:28143886-28143908 CTCAATCACCTGTTTAAGTCAGG + Intronic
1183030189 22:35097994-35098016 CTTAATCCTCTTTTAAAGTGGGG - Intergenic
1183217875 22:36492869-36492891 CTCAATGATCTCATGAAGTTTGG + Intronic
950802620 3:15566694-15566716 CATAATCATCTTTCTAAGGTAGG + Intronic
951430812 3:22604874-22604896 CTCAATAATTCATTTAAGTTTGG - Intergenic
951739698 3:25907154-25907176 CTCAAACATCTTCTTAAGTAAGG - Intergenic
952593542 3:34987989-34988011 CTCAAACATTTCTTTGAGTTGGG - Intergenic
955960561 3:64336739-64336761 GTCATACTTCTTTTTAAGTTGGG - Intronic
956944299 3:74201782-74201804 TTCTGTCATCTTTTTAAGTCAGG + Intergenic
956951492 3:74288592-74288614 ATCAGTCTTTTTTTTAAGTTTGG - Intronic
957430017 3:80092194-80092216 TTTAATTATCTTTTTAATTTGGG - Intergenic
957907954 3:86581843-86581865 TTCAACCTTCATTTTAAGTTCGG - Intergenic
958525013 3:95245830-95245852 CTCTATCATTTTTTCAAGGTGGG + Intergenic
958627483 3:96644716-96644738 ATCAATCTGCTTTTTATGTTTGG - Intergenic
959085577 3:101848874-101848896 CTCCAACATCTCTTTCAGTTCGG + Intronic
959786176 3:110301181-110301203 GTCAATGATCTCTTTAACTTGGG + Intergenic
959786407 3:110303910-110303932 GTCAATGATCTCTTTAACTTGGG + Intergenic
960826288 3:121788427-121788449 GTCTATCATCTTTTTAGGTCAGG - Exonic
962750461 3:138431227-138431249 TTCAGTCTTCTTTTTAATTTAGG + Intergenic
963926764 3:150959235-150959257 CTCAATAATCTTTTTAGGGGAGG + Intronic
964632495 3:158827043-158827065 TTTAAGCATTTTTTTAAGTTTGG - Intronic
966444257 3:179983750-179983772 TTCATTCATCTATTTAATTTTGG - Intronic
971525991 4:27619666-27619688 CACAATCATCTTTTTCATCTGGG - Intergenic
971711588 4:30119911-30119933 CTTATTAATCTTCTTAAGTTGGG - Intergenic
971806228 4:31361362-31361384 GTCAATTATTTTTATAAGTTTGG + Intergenic
971868981 4:32211195-32211217 CTCAATAATCTCTTTGGGTTGGG - Intergenic
975283687 4:72592798-72592820 CTCTATCATGTTTCCAAGTTTGG - Intergenic
975572362 4:75831171-75831193 CTCCAGCATATTTTTTAGTTAGG - Intergenic
975631955 4:76413190-76413212 CTCATTCATTTTTTTAAATGTGG - Intronic
976608415 4:87004456-87004478 CTCAATAATTTTTTTAATTTTGG - Intronic
977036645 4:91961819-91961841 CTGAACCACCTTTTTCAGTTAGG + Intergenic
977327988 4:95601607-95601629 CTCAAGATTCTTTTTCAGTTGGG - Intergenic
977543200 4:98343633-98343655 CTCACTGTTCTTTTTTAGTTTGG + Intronic
979399781 4:120234446-120234468 CTCAAACATCTTTTGAAACTGGG - Intergenic
979680727 4:123456612-123456634 CTCAATCTTGATTTTAAGTTAGG - Intergenic
979753729 4:124312832-124312854 CTAAATCATCTTATTCTGTTGGG - Intergenic
980247276 4:130264086-130264108 CTGATTCTTCTTTTAAAGTTTGG + Intergenic
980728154 4:136791714-136791736 CTCCTTCCTCTTTTGAAGTTTGG - Intergenic
980759201 4:137206558-137206580 CTCAAGCAACTTTTTTTGTTTGG - Intergenic
980985924 4:139694025-139694047 CTCAATCATCTTTTAAAGCTGGG - Intronic
981689678 4:147493787-147493809 CTGAAGCATCTATTTAAATTTGG + Intronic
983361509 4:166729151-166729173 ATCTATCATATTTTTAAGATGGG - Intergenic
983599557 4:169510817-169510839 CTCACTCATCCTCTTAAGATGGG + Intronic
983735737 4:171057595-171057617 CTCTTCCATCTTGTTAAGTTCGG + Intergenic
983967989 4:173836937-173836959 TTCAATCAACTTTTAAAGGTTGG + Intergenic
985036581 4:185846559-185846581 CTCAGTCATGTTTTAAAGTCAGG - Intronic
985180352 4:187254302-187254324 CTCAATCATCTTTTTTCTTAAGG - Intergenic
986114469 5:4758057-4758079 CTGAATCATCTTTTTATTTTGGG + Intergenic
986677187 5:10196310-10196332 CTGTTTCATCTTTGTAAGTTAGG - Intergenic
987910105 5:24131899-24131921 CTCATTCAACTTTTTTACTTTGG + Intronic
989020512 5:37000319-37000341 TTTAATCATCTTTTTAAATGAGG + Intronic
989919060 5:49774812-49774834 CACAATCATCTTTGTAATGTGGG + Intergenic
989932336 5:49971216-49971238 CACAATCATCTTTGTAATGTGGG + Intergenic
989938413 5:50110879-50110901 CACAATCATCTTTGTAATGTGGG - Intergenic
989938695 5:50115307-50115329 CACAATCATCTTTGTAATGTGGG - Intergenic
991488307 5:67160602-67160624 ATCAGTATTCTTTTTAAGTTTGG + Intronic
991548373 5:67808727-67808749 CTCAAACATCTTTGCAAGGTAGG - Intergenic
992180711 5:74195368-74195390 CTCAATCATTTTTATCAGTTTGG - Intergenic
992772895 5:80065136-80065158 TTCCATCACCTTTTTAGGTTAGG - Intronic
993863435 5:93163597-93163619 CTCAAACAGCTTTTTAAATTAGG + Intergenic
994559078 5:101344867-101344889 CTGAATTGTGTTTTTAAGTTGGG + Intergenic
995405652 5:111792379-111792401 TCCAATCATTTTATTAAGTTGGG - Intronic
996083585 5:119281637-119281659 CTAAACCATTTTTTTAAGGTGGG - Intronic
996837842 5:127813677-127813699 CTGAATCATTTTTTTAAATATGG - Intergenic
1000032301 5:157413799-157413821 TTAAATCTTCTTTGTAAGTTTGG - Intronic
1000520536 5:162289544-162289566 CTCAATCATCATTATAAATAAGG - Intergenic
1000739424 5:164948473-164948495 TTCAATCATATTTTTCAGTGTGG + Intergenic
1001364894 5:171126886-171126908 TTAGATCATCTTTATAAGTTTGG - Intronic
1001812084 5:174636472-174636494 CTCAATCATCTTGTCAATGTGGG + Intergenic
1001888182 5:175315120-175315142 CAGAATCATCTTTTTTGGTTAGG - Intergenic
1003216836 6:4121280-4121302 CTCCACTATTTTTTTAAGTTAGG + Intronic
1004441672 6:15661059-15661081 GTCAATCATTTTTGTTAGTTTGG - Intronic
1004524000 6:16389033-16389055 CACTATCATCTTTTTAATTTAGG - Intronic
1009830524 6:68925838-68925860 CTGATTCATCTTTATAACTTTGG + Intronic
1009955843 6:70451782-70451804 CTCAATCAACATTATAAATTAGG - Intronic
1010587898 6:77676853-77676875 CTAATTCATCTTTTTATGTTTGG + Intergenic
1011471512 6:87712616-87712638 ATCAATCATCTTTTAAAGCTTGG + Intergenic
1011494179 6:87922342-87922364 CTCAATCATCTTTGTATGCCTGG + Intergenic
1011978560 6:93340447-93340469 CTCAAAATTCTTTTTAACTTTGG - Intronic
1012356208 6:98317375-98317397 CTCAACAATCTTTATAATTTTGG + Intergenic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1013713103 6:112924454-112924476 CTAAATCATCTGTTTAAGCAAGG - Intergenic
1016002226 6:139053308-139053330 ATCAATAATCTTTTGAAGTTAGG - Intergenic
1017217250 6:151923290-151923312 CTAAATTAACTTTTTAAGTTTGG + Intronic
1018007638 6:159638018-159638040 CTCAACCATCTTTTATATTTTGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018907384 6:168083419-168083441 CTGAATCACTTTTTGAAGTTCGG - Intergenic
1022958215 7:35400881-35400903 CTCACTCATCTTTTTAAATAAGG + Intergenic
1023073975 7:36465087-36465109 CTCAAGCTTCTTTTTATATTTGG + Intergenic
1023300338 7:38763944-38763966 CATAATCATCTTTTGAAATTAGG + Intronic
1024174592 7:46825995-46826017 GTCAACCATCTTTTTAATGTAGG - Intergenic
1024711034 7:52014751-52014773 CTCAATCATAATTTTAAATGAGG - Intergenic
1026605623 7:71813626-71813648 CCCAAAGATCTTTTAAAGTTTGG - Intronic
1027547591 7:79548180-79548202 CCAAAACATCTTTTTAATTTTGG + Intergenic
1028542832 7:91962770-91962792 ATCCATTATCTTTTTAATTTGGG + Intronic
1028917634 7:96277009-96277031 TTCAATCATTGTTTCAAGTTGGG - Intronic
1029011466 7:97266335-97266357 CTCAAACATCTTTTTATGTTGGG + Intergenic
1030962314 7:115941126-115941148 CTCAGACTTTTTTTTAAGTTTGG + Intronic
1032654613 7:133914239-133914261 CTCTTTCATCCTTTTGAGTTTGG - Intronic
1032669636 7:134071448-134071470 CTCAAGCTTCTTTTTATATTGGG + Intergenic
1034916553 7:155044649-155044671 CTCAAGCTTCTTTTTATATTGGG - Intergenic
1035451457 7:158979752-158979774 CTGAATCATCGTTTCCAGTTAGG - Intergenic
1037689783 8:21172118-21172140 CTCCATCATCCTTATCAGTTGGG + Intergenic
1038560355 8:28572299-28572321 CTAAAAGATCTTTTAAAGTTTGG - Exonic
1039290603 8:36090438-36090460 CTCAAACTTCTTTTTATTTTGGG + Intergenic
1041732251 8:61074705-61074727 CACAATCATCATTTTAAGATGGG - Intronic
1041960068 8:63604269-63604291 TTCAATGATTTTTTTAAATTTGG + Intergenic
1043264271 8:78243497-78243519 CTCAATTTTCTTTTTAGTTTAGG - Intergenic
1043978616 8:86612164-86612186 CTCAATTATCTTCTTAAGGCAGG + Intronic
1044104928 8:88192621-88192643 CTCTATCTTCTTTTTCAGTTTGG - Intronic
1050762175 9:9086100-9086122 TTCAATTTTCTTTTTAAGTAAGG + Intronic
1052151199 9:25117945-25117967 CTCAATCATCTTTCTTTTTTTGG + Intergenic
1055667223 9:78564660-78564682 ATAAATCATCTTATTAATTTTGG + Intergenic
1056277980 9:85011877-85011899 ATCCCTCATCTTTTTAAGTTGGG + Intronic
1058000656 9:99861786-99861808 CTAAATTAATTTTTTAAGTTGGG - Intronic
1059133098 9:111775608-111775630 ATTAATCCTCTTTGTAAGTTGGG - Intronic
1061752283 9:132787811-132787833 TTAAATCATCTTTTTAACTTGGG + Intronic
1185961186 X:4547039-4547061 CTCAATTATGTTTCTAAGCTTGG + Intergenic
1186054911 X:5639948-5639970 CTCAAACATTTTTTTTTGTTAGG + Intergenic
1188399392 X:29726437-29726459 CTCAATCAGTTTCTTCAGTTTGG + Intronic
1188973809 X:36649835-36649857 ATAAAGCATCTTTTAAAGTTAGG + Intergenic
1189102194 X:38202261-38202283 TTCAATCTTCTTTTTAATCTTGG + Intronic
1191600305 X:62996873-62996895 CTGAACCATCTGTTGAAGTTGGG - Intergenic
1192874082 X:75210417-75210439 GCCAATTATCTTTTTAAGATGGG + Intergenic
1194050090 X:89057479-89057501 GTAAATTATCTTCTTAAGTTTGG - Intergenic
1194582167 X:95687990-95688012 TTCTTTCATTTTTTTAAGTTGGG - Intergenic
1196562872 X:117172177-117172199 ATCAATCAATTTTTTAAGTGGGG + Intergenic
1197156918 X:123280607-123280629 TTCAATCATATTTTTAAGGTGGG - Intronic
1197608140 X:128608261-128608283 CTCAAAAATCATTTTCAGTTTGG - Intergenic
1197651028 X:129064011-129064033 CTCCATCACTTTTTAAAGTTTGG - Intergenic
1198219690 X:134588005-134588027 GTCAATCACATTTTTAAGTGGGG - Intronic
1199864171 X:151828099-151828121 CACAATAATCTTTTGAAGTGTGG - Intergenic
1200945657 Y:8833586-8833608 TTCAATCATTTGTTTAAGTCGGG + Intergenic
1201939352 Y:19443306-19443328 CTGAATGATCTTTTGAATTTCGG - Intergenic