ID: 920132343

View in Genome Browser
Species Human (GRCh38)
Location 1:203742002-203742024
Sequence AAGTAGACACAAGCCCTCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920132343_920132346 25 Left 920132343 1:203742002-203742024 CCCTTGAGGGCTTGTGTCTACTT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 920132346 1:203742050-203742072 TGTGTTCTAGTTTCCATAATAGG 0: 1
1: 0
2: 1
3: 10
4: 228
920132343_920132345 -8 Left 920132343 1:203742002-203742024 CCCTTGAGGGCTTGTGTCTACTT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 920132345 1:203742017-203742039 GTCTACTTTTTAAAAGTCAATGG 0: 1
1: 0
2: 2
3: 47
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920132343 Original CRISPR AAGTAGACACAAGCCCTCAA GGG (reversed) Exonic
902684551 1:18067498-18067520 TAGGCGACACAAGTCCTCAAGGG - Intergenic
903433318 1:23326271-23326293 AAGTAGAAACAAGACATCTATGG + Intronic
903727231 1:25458821-25458843 AAGTACACACAAGGACTTAATGG + Exonic
904277204 1:29392344-29392366 AAGTAGAGAAAAGCCTGCAAGGG - Intergenic
904361163 1:29972867-29972889 AAGGAGATCCAAGCCCTCTATGG - Intergenic
909899572 1:81115663-81115685 AAGTAGTCACATGGCCTCAAGGG + Intergenic
912754003 1:112309291-112309313 AGGAAGACACAGTCCCTCAAGGG + Intergenic
913051291 1:115119098-115119120 ACATAGACACCAGCACTCAATGG + Intergenic
915416235 1:155745479-155745501 AAGAAGAGATAAGACCTCAAGGG + Intergenic
916238789 1:162617801-162617823 AAATAGAGACAAGCCCTGAGGGG + Intergenic
917070839 1:171148996-171149018 AACTACACACCAGCCCTCAGGGG + Intronic
919486233 1:198150743-198150765 AAGTAGATTCTAGCCCTCAGGGG + Intergenic
920132343 1:203742002-203742024 AAGTAGACACAAGCCCTCAAGGG - Exonic
924173212 1:241362719-241362741 AAGGAGACACATGCTCTGAAAGG - Intergenic
1063258751 10:4359154-4359176 AAGTAAACAAAAACCCTCCATGG + Intergenic
1064776488 10:18783821-18783843 AAGTTGACACAAGCAAGCAATGG - Intergenic
1068070610 10:52189861-52189883 AAGCTGACAACAGCCCTCAATGG - Intronic
1069041406 10:63699363-63699385 AAATAGACCCAAGGCCTCAAGGG - Intergenic
1072506471 10:96072766-96072788 AAGTAGAGAGAAGCCTACAAAGG + Intergenic
1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG + Intergenic
1077482142 11:2820764-2820786 ACGCAGACTCAAACCCTCAATGG - Intronic
1079970497 11:27030392-27030414 AAGCAGACACAAGTCTTTAAAGG + Intergenic
1082832455 11:57628863-57628885 AGGATGACACAAACCCTCAAGGG + Intergenic
1083953010 11:65967190-65967212 AGGTCGCCACAAGCCCTCGAGGG - Intronic
1084383866 11:68829962-68829984 AAGTGGACACGAGCCCTGAAAGG + Intronic
1084497139 11:69511795-69511817 AAGCAGACAGAAGCCCTCAAGGG - Intergenic
1085815795 11:79735759-79735781 ATGCAGACACAGGCCCTCACTGG + Intergenic
1086086577 11:82961551-82961573 AACTAGACACCATCTCTCAATGG + Intronic
1086843272 11:91716165-91716187 AACTAGACATAAGCCTTCAGTGG + Intergenic
1089109098 11:116040591-116040613 AATTAGACTCAAGCTCCCAAAGG - Intergenic
1093925519 12:24904534-24904556 AATTGGACAGAAGCCCTTAATGG - Intronic
1095064928 12:37760634-37760656 AATTAGACAGAAGCACTCGAAGG + Intergenic
1095972671 12:47913886-47913908 CAGCAGAAACAAGCCCACAAAGG + Intronic
1098444702 12:70554395-70554417 AATAACACACAAGACCTCAATGG + Intronic
1099655924 12:85491023-85491045 AAGTGGACAAAAGACCTGAATGG - Intergenic
1100001684 12:89844354-89844376 AAGGAAACACAAGCCAGCAAAGG - Intergenic
1101260713 12:103026874-103026896 AAGTAGGAAAAAGCCCTCCAAGG - Intergenic
1102329824 12:112019646-112019668 GAGTGGAAACAAGCCCACAAGGG - Intronic
1102379621 12:112453069-112453091 AAGTAGACACATTCCTCCAAGGG - Intronic
1102592455 12:113966990-113967012 AAGTAGACACAAAGGCTCAGAGG - Intergenic
1104267284 12:127245258-127245280 CAGGAGCCACAGGCCCTCAATGG - Intergenic
1106032806 13:26017958-26017980 AAGTAGACAAAAGCCCCCTGTGG + Intronic
1107826272 13:44331628-44331650 AATGAGACACCAGCCCTCTAAGG - Intergenic
1112770414 13:102788977-102788999 AAGTGGAAATAAGCCTTCAAGGG + Intronic
1113712333 13:112475904-112475926 AAGTAGACACAAGTCAGTAAGGG + Intergenic
1114880841 14:26784041-26784063 AAGTCCACACAATCCTTCAAAGG + Intergenic
1116897228 14:50328409-50328431 GAGTAGACACCAGACCTCAGTGG + Exonic
1119107866 14:71940966-71940988 AAATAGACACAAGCTCTTAAAGG - Intronic
1120959774 14:90114202-90114224 AAGTACACACAAGTCCACGAAGG - Intronic
1123192432 14:106583909-106583931 CAGTAGACCAAGGCCCTCAAAGG - Intergenic
1126268496 15:46783510-46783532 AAATTGACACAAGAGCTCAATGG - Intergenic
1127344865 15:58084248-58084270 AAGGAGAGTCAAGCCCCCAAGGG - Intronic
1133636476 16:7670712-7670734 AAGTATACACAAGCCTTTATAGG + Intronic
1134008158 16:10832207-10832229 CAGCAGACAAAGGCCCTCAAAGG + Intergenic
1136990881 16:35150824-35150846 AGGGAGCCACATGCCCTCAATGG - Intergenic
1138419096 16:56887593-56887615 AAGGTGACACAAGCCCCCACAGG - Intronic
1139259774 16:65580278-65580300 AAGTAGAGAAAGGCCCTCCATGG + Intergenic
1139515786 16:67451616-67451638 AAGCAGACACAGGCCCTGATGGG + Intronic
1147924817 17:43939818-43939840 AAGTAGAAACAGGTCCTAAAAGG - Intergenic
1203170920 17_GL000205v2_random:147370-147392 AAGTAGACACAAATCCCCATGGG + Intergenic
1155667022 18:28323130-28323152 AAGCAGACAAAAACCTTCAAAGG - Intergenic
1157363903 18:47045701-47045723 AACTAGACAAAAGCCATAAAAGG - Intronic
1159604591 18:70461870-70461892 AGAAAGACACAAGCACTCAAAGG - Intergenic
1161952684 19:7476676-7476698 GAGTAGAGAACAGCCCTCAATGG + Intergenic
1162331576 19:10033025-10033047 AATTAGACAACAGCCCTCAGTGG - Intergenic
1165616124 19:37202544-37202566 AATTATACAGAAGCCCTTAAAGG - Intronic
1166919434 19:46219010-46219032 AAGGATTCACAAGACCTCAAGGG - Intergenic
1167030159 19:46953574-46953596 AAGAACACACAAGTCCTCAAGGG - Intronic
926361757 2:12094690-12094712 AAGTATACACAATTACTCAATGG - Intergenic
931313301 2:61103002-61103024 AACTAGAAACAAGCCATCAGTGG + Intronic
933467432 2:82672342-82672364 AAGTAGAAACATTCCCTAAAGGG - Intergenic
945032111 2:205675333-205675355 AAGCAGAAACAAGCTCTCATGGG - Intergenic
947756230 2:232567339-232567361 AAGTAGCCAGAAGCCCTAGAGGG - Intronic
948022731 2:234749604-234749626 AAGTAGAGAGCAGCCCTCAGGGG - Intergenic
948537323 2:238655837-238655859 AAGGAGACACAAGGCCCCAGAGG + Intergenic
1172867128 20:38108869-38108891 AAGTAGAAACAAATCCTCCAGGG - Intronic
1173448359 20:43139886-43139908 AAGGAGACAAAAGCCTCCAAGGG + Intronic
1173942704 20:46925285-46925307 AAGTTTACTCAAGCACTCAAGGG + Intronic
1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG + Intergenic
1176330801 21:5547010-5547032 AAGTAGACACAAATCCCCATGGG - Intergenic
1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG + Intergenic
1176400853 21:6311750-6311772 AAGTAGACACAAATCCCCATGGG - Intergenic
1176436304 21:6677354-6677376 AAGTAGACACAAATCCCCATGGG + Intergenic
1176440201 21:6715163-6715185 AAGTAGACACAAATCCCCATGGG - Intergenic
1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG + Intergenic
1176464463 21:7042232-7042254 AAGTAGACACAAATCCCCATGGG - Intergenic
1176484127 21:7386202-7386224 AAGTAGACACAAATCCCCATGGG + Intergenic
1176488024 21:7424011-7424033 AAGTAGACACAAATCCCCATGGG - Intergenic
1178482271 21:32989893-32989915 AAGGAGACAGAAGCCCCCAGGGG + Intergenic
1182376072 22:29849039-29849061 AGGTAGAAACAATTCCTCAAGGG + Intergenic
949406020 3:3715786-3715808 CAGTAGACACAGGCTCTGAACGG + Intronic
950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG + Intronic
952257854 3:31710882-31710904 AAGCAGACACCAGGCCTGAAAGG + Intronic
954576600 3:51679791-51679813 AACAAGATACCAGCCCTCAAAGG - Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958610247 3:96416063-96416085 AAGTAGACAAAAGCAAGCAATGG - Intergenic
960280716 3:115778784-115778806 AATTGGCCACAAGCCCTCAATGG - Intergenic
961486448 3:127220652-127220674 ATGTTCACACAAGCCCTAAAAGG + Intergenic
962396553 3:135019381-135019403 AAGCAGACATAAGCCTTTAAAGG + Intronic
964867517 3:161277478-161277500 AAATAGACACAAACCTTCTATGG + Intergenic
966662865 3:182433955-182433977 AAGTGGATACAAGGCCCCAAAGG - Intergenic
968745249 4:2356579-2356601 AAGTAAACACATTCCCTCCATGG + Intronic
971004175 4:22355832-22355854 AAGTAGACAGAAACCAACAAGGG + Intronic
976712490 4:88087235-88087257 AGATAAACACAAGCCCACAAGGG + Intergenic
980960039 4:139465938-139465960 AAGTAGAGACAAGGTCTCACTGG + Intronic
983527238 4:168771656-168771678 AAGTGTAGACAAGCCCTCTATGG - Intronic
985068023 4:186142484-186142506 AAATAGACCCCAGCTCTCAATGG - Intronic
988557760 5:32252602-32252624 ATGTAGACACAAGCTCTTCAGGG - Intronic
989857755 5:46319539-46319561 AAGTAGAAAGAAGCCCTCTGGGG - Intergenic
992434916 5:76746716-76746738 AAGTAGAGACAAGGTCTCACGGG - Intergenic
995276951 5:110288037-110288059 AAAGAGACCCAACCCCTCAATGG - Intergenic
995477632 5:112563814-112563836 GAGAAGCCACAGGCCCTCAATGG + Intergenic
997981414 5:138469891-138469913 AAGTAGGCACAAGGCCTTTAGGG + Intergenic
998106870 5:139474276-139474298 AAGTAGACACAGGTCCTAAGTGG + Intergenic
1003785276 6:9478839-9478861 AAGTAGAATCCAACCCTCAAGGG + Intergenic
1004753273 6:18585094-18585116 CATTAGTCACCAGCCCTCAAAGG - Intergenic
1007859922 6:44898115-44898137 AAGTTAACAAAAGGCCTCAAAGG - Intronic
1013777794 6:113698275-113698297 AAGTGGACACAAGGCCTCTAAGG + Intergenic
1013996301 6:116312326-116312348 ATTCAGACACAAGCACTCAAGGG + Intronic
1016212354 6:141553558-141553580 AAATAGTCAGATGCCCTCAAAGG - Intergenic
1018709819 6:166490270-166490292 AAAAAGACACAAGGCCTCCAGGG - Intronic
1018907707 6:168085027-168085049 AAGCAGACACATTCCCACAAAGG + Intergenic
1020716874 7:11685549-11685571 AAGTAGGCAAAAGCCATAAATGG + Intronic
1022485526 7:30774530-30774552 AAGTAGACACAGGTCCTTTATGG - Intronic
1022939748 7:35222811-35222833 AAGTCCAGACAAGGCCTCAAAGG - Intronic
1023916169 7:44590967-44590989 AAATAGACTCCACCCCTCAATGG - Intergenic
1024422930 7:49190707-49190729 AAAGAGACACAAGGTCTCAAAGG + Intergenic
1025626051 7:63223456-63223478 AAGGAGAAATAAGCCCTCTAAGG + Intergenic
1025656067 7:63519669-63519691 AAGGAGAAATAAGCCCTCTAAGG - Intergenic
1026189910 7:68116258-68116280 AAGGAGACGTAAGCCCTCTAAGG + Intergenic
1029969813 7:104778082-104778104 AAGTAGACCCAGGTCCTAAAAGG + Intronic
1034311014 7:150087765-150087787 AAGAAAACACAAACTCTCAAAGG + Intergenic
1034710433 7:153186137-153186159 CAGTGGAGAAAAGCCCTCAAAGG - Intergenic
1038182136 8:25239425-25239447 AAGTAAGCAGAAGCTCTCAAAGG - Intronic
1039226685 8:35396347-35396369 AAGCAGGCACAAGCAGTCAAGGG + Intronic
1042738452 8:72015936-72015958 CAGAAGACACAAGCCCATAAAGG - Intronic
1044398817 8:91745574-91745596 AAGGAGACAGATGGCCTCAAGGG - Intergenic
1046665878 8:117002316-117002338 AAGTAGTTTCTAGCCCTCAATGG + Intronic
1048547675 8:135402826-135402848 GAGAAGACACAAGGACTCAAAGG - Intergenic
1048818630 8:138358462-138358484 AAGAGGACCCAAGCCCTCTATGG - Intronic
1051696576 9:19774310-19774332 AAGTAAACACAAGCCCAGAGAGG + Intronic
1052476596 9:28968915-28968937 TAGTAGACACATGCTCCCAAAGG + Intergenic
1059143286 9:111874570-111874592 AATTAGACACCACCTCTCAAAGG + Intergenic
1061102240 9:128500813-128500835 AAATGGACACAAGCCCTCGAGGG - Exonic
1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG + Intergenic
1203435213 Un_GL000195v1:131307-131329 AAGTAGACACAAATCCCCATGGG - Intergenic
1185558311 X:1038754-1038776 AAGCAGACAGCAGCCCTCACCGG - Intergenic
1187055091 X:15735326-15735348 TTGAATACACAAGCCCTCAATGG - Intronic
1187528787 X:20077913-20077935 ATGTAGACACACGCCCTTTATGG + Intronic
1189087633 X:38042762-38042784 AAGAAGACCCATCCCCTCAAAGG + Intronic
1189890420 X:45595982-45596004 AGGTACACAGAAGCCTTCAAAGG + Intergenic
1190278630 X:48914978-48915000 AAGTAAAAACAATCCCTCCAGGG + Intronic
1192771884 X:74202101-74202123 AAGTAGAAACAACCAATCAATGG + Intergenic