ID: 920139753

View in Genome Browser
Species Human (GRCh38)
Location 1:203800239-203800261
Sequence TAAGTTGCCCCATGTGTAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920139750_920139753 -3 Left 920139750 1:203800219-203800241 CCAGGTTGCCATCCAGTATCTAA 0: 1
1: 0
2: 1
3: 10
4: 75
Right 920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 92
920139748_920139753 8 Left 920139748 1:203800208-203800230 CCGGCTTTGACCCAGGTTGCCAT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 92
920139749_920139753 -2 Left 920139749 1:203800218-203800240 CCCAGGTTGCCATCCAGTATCTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920139753 Original CRISPR TAAGTTGCCCCATGTGTAGT TGG Exonic
900217138 1:1487574-1487596 GCTGTTGCCCCATGTGTGGTTGG + Intronic
900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG + Intronic
900590245 1:3456213-3456235 TCAGTTTCCTCATGTGTAGGTGG - Intronic
902165563 1:14568625-14568647 TAAGAATCCCCATGTGTTGTGGG - Intergenic
902732125 1:18376520-18376542 TCAGTTTCCCAATGTGTAATTGG + Intronic
903763128 1:25713110-25713132 TCAGTTTCCCCATCTGTAATGGG - Intronic
904465038 1:30702551-30702573 TAAGATGCCCCAAGTGAAGGGGG - Intergenic
904913075 1:33949911-33949933 TAATTTGGGCCATGTGCAGTTGG - Intronic
907562520 1:55403715-55403737 TTAATTGCCCCATTTGTATTTGG + Intergenic
911040491 1:93587508-93587530 AAAGTTGCCCAATGTGGAGCCGG + Intronic
913595400 1:120371343-120371365 TTATTTGCTCCATGTGTAGCTGG - Intergenic
914091874 1:144507632-144507654 TAATTTGCTCCATGTGTAGCTGG + Intergenic
914306663 1:146426232-146426254 TTATTTGCTCCATGTGTAGCTGG - Intergenic
914595386 1:149146570-149146592 TTATTTGCTCCATGTGTAGCTGG + Intergenic
915066968 1:153232715-153232737 AGAGTTGCCCCATGTGCATTTGG + Intergenic
917076755 1:171214073-171214095 AAATTTGCACCATTTGTAGTGGG - Intergenic
917429418 1:174950333-174950355 TATTTTGCCCCATGTGTCTTGGG - Intronic
919633398 1:199980874-199980896 CAGGTAGGCCCATGTGTAGTGGG - Intergenic
919941321 1:202288519-202288541 TCAGTTTCCCCATCTGTACTGGG + Intronic
920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG + Exonic
1066467032 10:35661076-35661098 TTAGTTTTCCCATGTGTATTGGG - Intergenic
1069305048 10:66958729-66958751 TAGTTTGCCCCAGGAGTAGTAGG - Intronic
1071918548 10:90324222-90324244 GCAGTTTCCCCATTTGTAGTAGG - Intergenic
1081141645 11:39508611-39508633 TAAGTTGCACCATCTGAAGTTGG - Intergenic
1083204520 11:61140251-61140273 TCAGTTTCCCCATTTGCAGTAGG + Intronic
1094557477 12:31516058-31516080 TAGGTTGCCCCTTGTTTATTGGG + Intronic
1101317268 12:103640865-103640887 TCAGTTGCTCCATGTGTAAAAGG + Intronic
1102564936 12:113790415-113790437 TTAGTTCCCCCATGTGTTGTGGG - Intergenic
1105884785 13:24632450-24632472 ACAATTGCCCCATGTGTAGGGGG + Intergenic
1108864296 13:54904217-54904239 TAGGTTTTCTCATGTGTAGTTGG - Intergenic
1110157540 13:72336056-72336078 TATGATGCCTCATGTGTACTAGG - Intergenic
1110430781 13:75420736-75420758 TAAGTTACACCAAATGTAGTGGG + Intronic
1117432248 14:55679067-55679089 TTAGTTGCCCCATCTGTAAAAGG + Intronic
1120937520 14:89911960-89911982 TTAGTTTCCCCATCTGTAGAGGG - Intronic
1127550216 15:60030140-60030162 TCAGTTTCCCCATCTGTAGATGG + Intronic
1133971490 16:10571381-10571403 TAAGGTGCCCCCAGTGTGGTTGG - Intronic
1134116304 16:11551369-11551391 TCAGTTTCCCCATCTGTAGACGG - Intronic
1135620911 16:23954699-23954721 TCAGTTTCCCCATCTGAAGTTGG + Intronic
1138088386 16:54154543-54154565 TGAGATGGCCCATGTGCAGTTGG + Intergenic
1138515190 16:57532086-57532108 TCAGTTTCCCCATGTGTAGAAGG + Intronic
1138838770 16:60472048-60472070 TAATTTCCCCAATGTATAGTTGG + Intergenic
1140154580 16:72410191-72410213 TAACTTGCCCCATGTTATGTAGG - Intergenic
1143905505 17:10205886-10205908 TAAGGAGCCCCATGTGCACTAGG + Intergenic
1145810720 17:27762441-27762463 TAAATTGTCCCAAGAGTAGTGGG + Intronic
1151473130 17:74330279-74330301 TCAGTTGCCTCATGTGTAAGTGG + Intronic
1161545803 19:4879084-4879106 TCAGTTTCCCCATGTGTAAAAGG - Intergenic
1165717190 19:38053958-38053980 TCAGTTGCCTCATTTGTATTTGG - Intronic
1167976152 19:53227490-53227512 TAAGTGGCCCCAGGGGTAGATGG + Intergenic
1168092480 19:54095323-54095345 TAGGTTCCCCCGGGTGTAGTCGG + Exonic
925604086 2:5640698-5640720 TTATTTGCTCCATGTGTAGCTGG - Intergenic
929555633 2:42924064-42924086 TCAGTTTCCCCATTTGTGGTGGG + Intergenic
933714420 2:85349731-85349753 TAAGGTACCCCATGTCTAGATGG - Intronic
937135682 2:119550080-119550102 AAACTGGCCCCATGTGTTGTTGG + Intronic
947601792 2:231455662-231455684 TAACTTGGGACATGTGTAGTAGG - Intronic
1170837539 20:19897499-19897521 TCAGTTTCCCCATCTGTAGAAGG - Intronic
1172193714 20:33077819-33077841 TCAGTTTCCCCATCTGCAGTGGG - Intergenic
1173917482 20:46719096-46719118 TAAGTTTCTCCATGTATATTTGG + Intronic
1175253128 20:57621767-57621789 TCAGTTTCCCCATGTGTAAAAGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1180246424 21:46550922-46550944 TAAGTTCCCCCATGCGTGGCTGG - Intronic
1181808905 22:25391724-25391746 TCAGTTTCCCCATCTGTAATAGG - Intronic
1183487892 22:38099216-38099238 TCAGTTGCCCCATCTGTAACAGG + Intronic
1184451406 22:44584869-44584891 TCAGTTTCCCCATCTGTAGGAGG - Intergenic
950867925 3:16204204-16204226 AAAGTTGCCACATGGCTAGTGGG - Intronic
951132513 3:19064618-19064640 TCAGTTTCACCATGTGTAGATGG - Intergenic
959331885 3:105016511-105016533 CAAGTGGCTCCAGGTGTAGTGGG + Intergenic
960865545 3:122195668-122195690 TCAGTTTCCCCATGTGTACTGGG - Intronic
963001092 3:140682551-140682573 TCAATTGCCCCATGTGCAGCCGG + Exonic
969225263 4:5792838-5792860 TAAGTTGACCAATGTGTATAAGG + Intronic
970289768 4:14559219-14559241 TCAGTTTCCTCATCTGTAGTTGG - Intergenic
970662237 4:18298784-18298806 TATGTTGTCCAATGTGTACTGGG + Intergenic
970672789 4:18415567-18415589 TTACTGGCCCCCTGTGTAGTAGG + Intergenic
972019337 4:34290549-34290571 TAAGTTGCACCATGTGTTCTTGG - Intergenic
980482784 4:133410057-133410079 CAACTGGCCCCATGTGCAGTTGG - Intergenic
982050890 4:151500500-151500522 TAAGTTGCCCCAAGTGACATGGG - Intronic
984269018 4:177528216-177528238 TAATTTGCTGCATTTGTAGTGGG + Intergenic
989483232 5:41957228-41957250 TAAGTTATCATATGTGTAGTTGG - Intergenic
993638408 5:90372826-90372848 TCAGTGGCCCCATTTGTAGATGG + Intergenic
994799676 5:104356979-104357001 TAAGTTGACCCATATTTATTTGG - Intergenic
997102360 5:130982576-130982598 TAATTGGCACCATGTGTAGAAGG - Intergenic
997521960 5:134528641-134528663 TAGGTTGCCCCAAGTGCTGTTGG + Intronic
999322706 5:150625070-150625092 TCAGTTTCCCCATCTGTAGGTGG + Intronic
999481898 5:151956322-151956344 TCAGCAGCCCCATGTGTAGCTGG + Intergenic
1000832237 5:166117121-166117143 TAAGATTAACCATGTGTAGTGGG - Intergenic
1005198253 6:23313842-23313864 AAAGTTGTCCCATTTGAAGTGGG + Intergenic
1007813777 6:44505699-44505721 TCAGTTTCTCCATCTGTAGTAGG - Intergenic
1023494252 7:40777773-40777795 TAAGTTGCCTCCTGTGAAGGAGG + Intronic
1027174956 7:75897380-75897402 TCAGTTTCCCCATCTGTAGTTGG + Intergenic
1032218591 7:129976860-129976882 AAACTTGCCCCATGTCTAGGAGG + Intergenic
1032903814 7:136341072-136341094 TAATTTGCTGCATGTATAGTTGG + Intergenic
1038666997 8:29546583-29546605 TAGATTCCCGCATGTGTAGTTGG + Intergenic
1047820455 8:128514122-128514144 TAATTTGCCCTAGGTGTTGTAGG + Intergenic
1048933588 8:139336871-139336893 TAAGTGGCCCCATAGGTGGTGGG - Intergenic
1052354485 9:27490177-27490199 TTAGTTCACCCATCTGTAGTAGG - Intronic
1053588423 9:39485054-39485076 AAAGTTGCCCCATTTGTGGCCGG + Intergenic
1060963924 9:127701358-127701380 TGAGTGGCCCCATGTGTGTTGGG - Intronic
1061673533 9:132202542-132202564 TGAGTTTCCCCATGTGTGGAAGG - Intronic
1187854201 X:23621154-23621176 TAAGTTTCTCTATGTGTAGATGG - Intergenic
1188338645 X:28971785-28971807 TAAGTGGACCCATCTGTATTTGG + Intronic
1192033376 X:67538815-67538837 TCAGATGCCCCATGTAAAGTGGG - Intergenic
1192203275 X:69080788-69080810 TCAGTTTCCCCATCTGTAGCTGG + Intergenic
1193596767 X:83455690-83455712 TAAGTTGCTCCATGTGTAAGTGG + Intergenic
1200826555 Y:7650930-7650952 TTAGTTTCTCCATGTGTAGGTGG + Intergenic