ID: 920140609

View in Genome Browser
Species Human (GRCh38)
Location 1:203809419-203809441
Sequence CAACCTGGGATTTCGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920140609_920140614 -10 Left 920140609 1:203809419-203809441 CCCATCTCCGAAATCCCAGGTTG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 920140614 1:203809432-203809454 TCCCAGGTTGCTGGGATTACAGG 0: 21
1: 2841
2: 71736
3: 474689
4: 496890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920140609 Original CRISPR CAACCTGGGATTTCGGAGAT GGG (reversed) Intronic
900835958 1:5004209-5004231 GAATCTGGGATTTTGGAGTTTGG - Intergenic
907269485 1:53282466-53282488 GAAACTGGGAGTTGGGAGATGGG + Intronic
909457103 1:75862014-75862036 CAACCTGGGATGTGGGAGCTTGG - Intronic
911217994 1:95216549-95216571 CAACCTGGGATGCTGGAGCTTGG - Intronic
911596124 1:99800636-99800658 CAACCTGGGATGCCGGAGCTTGG - Intergenic
911692043 1:100845494-100845516 CGACCTGGGATGTTGGAGGTTGG - Intergenic
914802142 1:150969650-150969672 CAACCTCTGATTTCGGGGAGTGG + Intronic
916406277 1:164500765-164500787 CAACCTGGGATGCTGGAGTTTGG + Intergenic
916637759 1:166692167-166692189 CAACCTGTGAATTCAGGGATGGG + Intergenic
919063919 1:192668686-192668708 CAACCTGGGACTCTGGAGCTTGG - Intergenic
920140609 1:203809419-203809441 CAACCTGGGATTTCGGAGATGGG - Intronic
1064899345 10:20276763-20276785 CAGCCAGGGATTTCAGAGAAGGG - Intronic
1066297548 10:34067871-34067893 CAACCTGGGACATGGGAGCTTGG + Intergenic
1067329455 10:45301401-45301423 CAACCTGGGATGACCGAGCTTGG - Intergenic
1068746211 10:60533416-60533438 TAGCCTGGGATTTAGAAGATTGG - Intronic
1068875895 10:61996405-61996427 CAAACTGGGAGTTCAAAGATTGG + Intronic
1069410409 10:68147576-68147598 GAACTTGGGATTTGGGACATGGG - Intronic
1071827546 10:89340207-89340229 CAACCTGGGATTGCTGAGCAGGG + Exonic
1078061050 11:8044706-8044728 CAACCTGGGACTTATGAAATGGG - Intronic
1078719637 11:13872518-13872540 CAGCCTGGGCTTTAGGAGGTTGG - Intergenic
1081031286 11:38087096-38087118 CCACCTGGGATTAGGGAGAATGG - Intergenic
1081605669 11:44525856-44525878 CAACCTGGGACTCCAGAGACCGG + Intergenic
1083531578 11:63428179-63428201 CAACCTGGGATGTTGGAGCTTGG + Intergenic
1086047257 11:82547557-82547579 CACCCTGGAATTTCATAGATAGG - Intergenic
1086348871 11:85924897-85924919 CAACCTGGGATGCTGGAGCTTGG + Intergenic
1087364192 11:97198438-97198460 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1087798887 11:102482792-102482814 GAAGCTGGGATTTCAGAGACAGG - Intronic
1088088756 11:106012590-106012612 CAACCTGAGATTCTGGAAATTGG - Intronic
1090229590 11:125092088-125092110 TAACCTGGGACCTGGGAGATGGG - Intergenic
1090372665 11:126267780-126267802 CAACCCTGGCTTTCAGAGATAGG + Intronic
1094579260 12:31718916-31718938 CGACCTGGGATGTGGGAGCTTGG - Intronic
1095547361 12:43387883-43387905 CAACCTGGGATGCTGGAGCTTGG - Intronic
1097850198 12:64404196-64404218 CAGCCGGGGATTTAGGAGCTGGG + Intergenic
1102345576 12:112159044-112159066 CAACCTGGGATGTTCGAGCTTGG - Intergenic
1107641964 13:42453023-42453045 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1107968845 13:45622235-45622257 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1110700695 13:78544435-78544457 CAATCTGGCTTTTAGGAGATGGG - Intergenic
1115008182 14:28511623-28511645 CAACCTGGGATGCCTGAGCTTGG - Intergenic
1118849629 14:69573786-69573808 CAGCCTGGGCTTTCCGACATCGG - Intronic
1119573901 14:75701062-75701084 CAACCTGTGATCTAGAAGATGGG - Intronic
1122219441 14:100227003-100227025 CAAACTAGGATTTGGGTGATTGG - Intergenic
1126476332 15:49068944-49068966 CAACCTGGGATATGGGAACTTGG + Intergenic
1131487670 15:92835443-92835465 TAGACTGGGATTTGGGAGATTGG + Intergenic
1135491288 16:22912009-22912031 CTACCTGGGAGTTCTGAGGTGGG + Intronic
1139066974 16:63328794-63328816 GAACCTGAGATTTTGGATATGGG + Intergenic
1140966383 16:79970136-79970158 CAACTTGGAATTTCTGAGATAGG - Intergenic
1141821100 16:86446520-86446542 CAACATGGGATTTTGGAGGATGG - Intergenic
1149191935 17:54073150-54073172 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1150626311 17:66843469-66843491 CTCTCTGGGATTACGGAGATAGG - Intronic
1151746563 17:76014718-76014740 GACCCTGGGAATTCAGAGATGGG + Intronic
1157058243 18:44256009-44256031 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1160661764 19:304501-304523 CAACCTGGGTGTTTGGGGATGGG - Intergenic
1161331724 19:3691792-3691814 CAACCTGGGATCTGAGAGATCGG + Intronic
1163824739 19:19516612-19516634 CACCCTTGGATTTCTAAGATGGG + Intronic
1165458964 19:35932998-35933020 CAACCTGGGATTACAGTGCTGGG - Intergenic
1166540153 19:43599711-43599733 CAACTTGGGCTTTTGGGGATGGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168176923 19:54633176-54633198 CAGCCTGGTATTTTTGAGATTGG - Exonic
925808462 2:7675128-7675150 CACCCTTGGATTTCGTAGCTCGG + Intergenic
926677414 2:15637889-15637911 CAATCTGGGCTTTCAGAGACAGG - Intergenic
926976533 2:18521570-18521592 CACCCTGGGTCTTCAGAGATTGG - Intergenic
928360138 2:30655990-30656012 CTGCCTGGAATTTCAGAGATAGG - Intergenic
929499601 2:42479133-42479155 AAAACTGGGATTCAGGAGATAGG - Intronic
933131401 2:78677627-78677649 CATCCTGAGATTTCTGAGAGTGG - Intergenic
935852255 2:107235601-107235623 CAACCTGGGATGACAGAGCTTGG + Intergenic
938091088 2:128435255-128435277 CAACCTGTGTCTTCAGAGATAGG - Intergenic
938250535 2:129812563-129812585 CAATCTGGGATTTCAGAAAATGG + Intergenic
939840609 2:147182795-147182817 CAACCTGGGATGCCTGAGCTTGG + Intergenic
1169313604 20:4569404-4569426 CAACATGGGATTTGGGAGGTGGG + Intergenic
1175334616 20:58187195-58187217 CAACCTGGGCTCTGGGAGAGTGG + Intergenic
1177448696 21:21236188-21236210 CATCTTGGGATTTCCTAGATAGG - Intronic
1178756575 21:35355545-35355567 CAACCTGGGAATTCACAAATAGG + Intronic
1179541475 21:42085811-42085833 CAACCTGGGAGTGCTGAGATGGG + Intronic
950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG + Intergenic
953923412 3:46967526-46967548 CCACCTGGGAGTTCTGAGACGGG - Intronic
954508195 3:51097459-51097481 CAACCTGGGATGCTGGAGCTTGG - Intronic
955143602 3:56293807-56293829 CATCTTGGGTTTTCTGAGATTGG - Intronic
958434524 3:94080757-94080779 CAACCTGGGATGCTGGAGCTTGG - Intronic
963689249 3:148478262-148478284 CAACTTGGGATTCTGGAGCTTGG + Intergenic
963898663 3:150712429-150712451 CAACCTGGGATGCTGGAGCTTGG + Intergenic
969903228 4:10369374-10369396 CAACCTGGGTCTTCTGACATAGG - Intergenic
971647685 4:29229901-29229923 CAACCTGGGATGCTGGAGCTTGG + Intergenic
973237646 4:47922780-47922802 CAACCTGGGATGCTGGAGCTTGG - Intronic
974719884 4:65725069-65725091 CAACCTGGGATGTGGGAGCTTGG + Intergenic
975663455 4:76709887-76709909 AAATCTGGGTTTTCTGAGATTGG + Intronic
975807275 4:78126126-78126148 CAACCTGGGATGCTGGAGCTTGG - Intronic
977656607 4:99529102-99529124 CAACCTGGGATTTTGATGATTGG - Intronic
978150313 4:105426602-105426624 CAACCTGGGATGTGGGAGCTTGG + Intronic
979315377 4:119255474-119255496 CAACCTGGGATGCGGGAGGTTGG - Intronic
984166403 4:176307791-176307813 CAACCTTAGTTTTCAGAGATAGG + Intergenic
985367359 4:189245747-189245769 CAACCTGGGATGCTGGAGCTTGG - Intergenic
989320712 5:40130905-40130927 CAACCTGGGATGTTTGAGCTTGG - Intergenic
992756481 5:79911387-79911409 CAACCTGGGATGCAGGAGCTTGG + Intergenic
993266448 5:85732256-85732278 CAACCTGGGATGCTGAAGATTGG + Intergenic
996970179 5:129357756-129357778 GAAACTGGGGTTTCGGAAATTGG - Intergenic
1003316812 6:5020370-5020392 CAACCTGGGATGTTGGAGCTTGG - Intergenic
1011234615 6:85202391-85202413 CAACCTGGGATGCTGCAGATTGG + Intergenic
1011578188 6:88827678-88827700 CAACCTGGGATGCTGGAGCTTGG + Intronic
1013625669 6:111934820-111934842 CAACCTGGGATGCTGGAGCTTGG - Intergenic
1022120066 7:27299471-27299493 CAACCTGGCAATTCAGAGAGGGG - Intergenic
1024510172 7:50197654-50197676 CAGCCTGGGAACTGGGAGATAGG + Intergenic
1033172202 7:139094103-139094125 CACCCTGGGATGTCTGGGATGGG - Intronic
1033325435 7:140374164-140374186 TATCCTGGCATTTCTGAGATGGG + Intronic
1034222457 7:149457001-149457023 CACCCTGGGGTTTCCGACATGGG + Intronic
1035342094 7:158169197-158169219 CAACCTGGGAGTTGGGAAGTGGG + Intronic
1038664584 8:29527133-29527155 CATCCTGAAATTTCGGAGGTTGG + Intergenic
1045839345 8:106561262-106561284 CAACCTGGGATGCTGGAGCTTGG + Intronic
1047099782 8:121664256-121664278 CAGCCTGGCATTTTAGAGATGGG - Intergenic
1048467052 8:134674385-134674407 CAACCTGGGATGCTGGAGCTTGG + Intronic
1049824505 8:144659941-144659963 GAACCTGGCATTTGGGAGAGAGG - Intergenic
1049872372 8:144990666-144990688 CAACCTGGGATGTTCGAGCTTGG - Intergenic
1056243517 9:84670901-84670923 CATCGTGGCATTTCCGAGATTGG + Exonic
1061765271 9:132877835-132877857 CAACCTGGCATTTCACAGGTGGG + Intronic
1062357140 9:136170370-136170392 CAACCTGGGATTTTGCAAACAGG - Intergenic
1189777086 X:44480109-44480131 CCACCTGGATTTTCTGAGATAGG + Intergenic
1190453371 X:50602676-50602698 CAACCTGAGATGGCAGAGATTGG - Exonic
1191002368 X:55674103-55674125 CTACCTGGGATGCAGGAGATTGG - Intergenic
1191135409 X:57058776-57058798 CAACCTGGGATTCTTGAGCTTGG - Intergenic
1192712611 X:73607335-73607357 CAACCTGGGATGTCTGAGCTTGG - Intronic
1193542456 X:82788662-82788684 CAACCTGGGATGCTGGAGCTTGG + Intergenic
1195415124 X:104611499-104611521 CAACCTGGGATGCTGGAGCTTGG - Intronic
1195868137 X:109455798-109455820 CAATCTGGAATTTAGGATATAGG - Intronic
1195985574 X:110626603-110626625 CAACCTGGGATGCTGGAGCTTGG + Intergenic
1196269807 X:113697764-113697786 CAACCTGGGATGCTCGAGATTGG - Intergenic