ID: 920144284

View in Genome Browser
Species Human (GRCh38)
Location 1:203844827-203844849
Sequence CAGAAAAAGGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3382
Summary {0: 1, 1: 0, 2: 25, 3: 350, 4: 3006}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920144284_920144294 -1 Left 920144284 1:203844827-203844849 CCCTCCTCCCTCCCCTTTTTCTG 0: 1
1: 0
2: 25
3: 350
4: 3006
Right 920144294 1:203844849-203844871 GCTTGGTATTGTGAAAGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 123
920144284_920144293 -2 Left 920144284 1:203844827-203844849 CCCTCCTCCCTCCCCTTTTTCTG 0: 1
1: 0
2: 25
3: 350
4: 3006
Right 920144293 1:203844848-203844870 TGCTTGGTATTGTGAAAGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920144284 Original CRISPR CAGAAAAAGGGGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr