ID: 920163338

View in Genome Browser
Species Human (GRCh38)
Location 1:204016907-204016929
Sequence CAAGCCTCTTCCCTTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920163338_920163341 -4 Left 920163338 1:204016907-204016929 CCAGTTTCAAGGGAAGAGGCTTG No data
Right 920163341 1:204016926-204016948 CTTGCCTCTCAATGTGGAGAGGG No data
920163338_920163340 -5 Left 920163338 1:204016907-204016929 CCAGTTTCAAGGGAAGAGGCTTG No data
Right 920163340 1:204016925-204016947 GCTTGCCTCTCAATGTGGAGAGG No data
920163338_920163339 -10 Left 920163338 1:204016907-204016929 CCAGTTTCAAGGGAAGAGGCTTG No data
Right 920163339 1:204016920-204016942 AAGAGGCTTGCCTCTCAATGTGG No data
920163338_920163343 18 Left 920163338 1:204016907-204016929 CCAGTTTCAAGGGAAGAGGCTTG No data
Right 920163343 1:204016948-204016970 GTTCAAGTCACTTCCTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920163338 Original CRISPR CAAGCCTCTTCCCTTGAAAC TGG (reversed) Intergenic
No off target data available for this crispr