ID: 920165445

View in Genome Browser
Species Human (GRCh38)
Location 1:204032377-204032399
Sequence TCTCATCTTCTGTAGCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920165443_920165445 12 Left 920165443 1:204032342-204032364 CCACTCTAGAGGCTGGAAAAATG No data
Right 920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG No data
920165438_920165445 25 Left 920165438 1:204032329-204032351 CCCTTACCAGTCTCCACTCTAGA No data
Right 920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG No data
920165441_920165445 19 Left 920165441 1:204032335-204032357 CCAGTCTCCACTCTAGAGGCTGG No data
Right 920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG No data
920165439_920165445 24 Left 920165439 1:204032330-204032352 CCTTACCAGTCTCCACTCTAGAG No data
Right 920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG No data
920165437_920165445 30 Left 920165437 1:204032324-204032346 CCTTTCCCTTACCAGTCTCCACT No data
Right 920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920165445 Original CRISPR TCTCATCTTCTGTAGCTGTA GGG Intergenic
No off target data available for this crispr