ID: 920170590

View in Genome Browser
Species Human (GRCh38)
Location 1:204070069-204070091
Sequence TCCAGGTGGGCATTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170590_920170605 17 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170605 1:204070109-204070131 GAACATAAAAAAGGGTGGCTGGG No data
920170590_920170602 9 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data
920170590_920170603 12 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170603 1:204070104-204070126 GGAGGGAACATAAAAAAGGGTGG No data
920170590_920170596 -9 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170596 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG No data
920170590_920170599 -5 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG No data
920170590_920170604 16 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170604 1:204070108-204070130 GGAACATAAAAAAGGGTGGCTGG No data
920170590_920170601 8 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170601 1:204070100-204070122 TGGAGGAGGGAACATAAAAAAGG No data
920170590_920170598 -6 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170598 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920170590 Original CRISPR TCCAGGTGGGCATTCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr