ID: 920170597

View in Genome Browser
Species Human (GRCh38)
Location 1:204070086-204070108
Sequence CCTCCTCCATCCTGGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170597_920170607 21 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170607 1:204070130-204070152 GGAAAGAGCAGCCAGTGAGGTGG No data
920170597_920170606 18 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170606 1:204070127-204070149 CTGGGAAAGAGCAGCCAGTGAGG No data
920170597_920170605 0 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170605 1:204070109-204070131 GAACATAAAAAAGGGTGGCTGGG No data
920170597_920170601 -9 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170601 1:204070100-204070122 TGGAGGAGGGAACATAAAAAAGG No data
920170597_920170608 22 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170608 1:204070131-204070153 GAAAGAGCAGCCAGTGAGGTGGG No data
920170597_920170604 -1 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170604 1:204070108-204070130 GGAACATAAAAAAGGGTGGCTGG No data
920170597_920170603 -5 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170603 1:204070104-204070126 GGAGGGAACATAAAAAAGGGTGG No data
920170597_920170609 25 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170609 1:204070134-204070156 AGAGCAGCCAGTGAGGTGGGAGG No data
920170597_920170602 -8 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920170597 Original CRISPR CCTCCTCCATCCTGGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr