ID: 920170602

View in Genome Browser
Species Human (GRCh38)
Location 1:204070101-204070123
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170591_920170602 8 Left 920170591 1:204070070-204070092 CCACAGGGAATGCCCACCTGGAG No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data
920170590_920170602 9 Left 920170590 1:204070069-204070091 CCCACAGGGAATGCCCACCTGGA No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data
920170594_920170602 -4 Left 920170594 1:204070082-204070104 CCCACCTGGAGACCAGGATGGAG No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data
920170597_920170602 -8 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data
920170595_920170602 -5 Left 920170595 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG No data
Right 920170602 1:204070101-204070123 GGAGGAGGGAACATAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr