ID: 920170607

View in Genome Browser
Species Human (GRCh38)
Location 1:204070130-204070152
Sequence GGAAAGAGCAGCCAGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170600_920170607 13 Left 920170600 1:204070094-204070116 CCAGGATGGAGGAGGGAACATAA No data
Right 920170607 1:204070130-204070152 GGAAAGAGCAGCCAGTGAGGTGG No data
920170597_920170607 21 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170607 1:204070130-204070152 GGAAAGAGCAGCCAGTGAGGTGG No data
920170594_920170607 25 Left 920170594 1:204070082-204070104 CCCACCTGGAGACCAGGATGGAG No data
Right 920170607 1:204070130-204070152 GGAAAGAGCAGCCAGTGAGGTGG No data
920170595_920170607 24 Left 920170595 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG No data
Right 920170607 1:204070130-204070152 GGAAAGAGCAGCCAGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920170607 Original CRISPR GGAAAGAGCAGCCAGTGAGG TGG Intergenic
No off target data available for this crispr