ID: 920170608

View in Genome Browser
Species Human (GRCh38)
Location 1:204070131-204070153
Sequence GAAAGAGCAGCCAGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170597_920170608 22 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170608 1:204070131-204070153 GAAAGAGCAGCCAGTGAGGTGGG No data
920170595_920170608 25 Left 920170595 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG No data
Right 920170608 1:204070131-204070153 GAAAGAGCAGCCAGTGAGGTGGG No data
920170600_920170608 14 Left 920170600 1:204070094-204070116 CCAGGATGGAGGAGGGAACATAA No data
Right 920170608 1:204070131-204070153 GAAAGAGCAGCCAGTGAGGTGGG No data
920170594_920170608 26 Left 920170594 1:204070082-204070104 CCCACCTGGAGACCAGGATGGAG No data
Right 920170608 1:204070131-204070153 GAAAGAGCAGCCAGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920170608 Original CRISPR GAAAGAGCAGCCAGTGAGGT GGG Intergenic
No off target data available for this crispr